Transcript: Human XM_011543463.3

PREDICTED: Homo sapiens DNA polymerase kappa (POLK), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POLK (51426)
Length:
5138
CDS:
758..3412

Additional Resources:

NCBI RefSeq record:
XM_011543463.3
NBCI Gene record:
POLK (51426)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543463.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365738 GGGTAGAACTGTTACCATTAA pLKO_005 2155 CDS 100% 13.200 10.560 N POLK n/a
2 TRCN0000371026 AGGAAATACTTGCTGATTATG pLKO_005 1302 CDS 100% 13.200 9.240 N POLK n/a
3 TRCN0000365754 AGGAATGGAAGGATTAGATAA pLKO_005 835 CDS 100% 13.200 9.240 N POLK n/a
4 TRCN0000116000 CCCAAACATACCCTTGATATA pLKO.1 3380 CDS 100% 13.200 9.240 N POLK n/a
5 TRCN0000115997 GCATTGATCCTAGTGTCTTTA pLKO.1 3796 3UTR 100% 13.200 9.240 N POLK n/a
6 TRCN0000371027 TAAATGTGAAGCCGTGAATAA pLKO_005 2548 CDS 100% 13.200 9.240 N POLK n/a
7 TRCN0000116001 CAGTTAATCAACCCAAAGAAA pLKO.1 3249 CDS 100% 5.625 3.938 N POLK n/a
8 TRCN0000115998 CCTGTTTGTAACGTAGAACAA pLKO.1 3137 CDS 100% 4.950 3.465 N POLK n/a
9 TRCN0000115999 GCCATTGCTAAGGAATTGCTA pLKO.1 2255 CDS 100% 3.000 2.100 N POLK n/a
10 TRCN0000365804 ATTAGAACAAAGCCGAAATTT pLKO_005 1033 CDS 100% 15.000 9.000 N POLK n/a
11 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 4411 3UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 4411 3UTR 100% 4.050 2.025 Y ORAI2 n/a
13 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 4411 3UTR 100% 4.050 2.025 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543463.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11986 pDONR223 100% 53% 51.2% None (many diffs) n/a
2 ccsbBroad304_11986 pLX_304 0% 53% 51.2% V5 (many diffs) n/a
3 TRCN0000471624 TTAGCCATCACTAACGCGATGTAG pLX_317 35.7% 53% 51.2% V5 (many diffs) n/a
Download CSV