Transcript: Human XM_011543861.3

PREDICTED: Homo sapiens ankyrin repeat domain 20 family member A3 (ANKRD20A3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD20A3 (441425)
Length:
3336
CDS:
1909..3249

Additional Resources:

NCBI RefSeq record:
XM_011543861.3
NBCI Gene record:
ANKRD20A3 (441425)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543861.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168760 GCACTGGACAAGGACAATAAT pLKO.1 2389 CDS 100% 15.000 7.500 Y ANKRD20A1 n/a
2 TRCN0000262907 ATGCAGAAGATTATGCTATTT pLKO_005 2609 CDS 100% 13.200 6.600 Y ANKRD20A4 n/a
3 TRCN0000167112 CACAGGTCAAAGAAGGAAATA pLKO.1 3056 CDS 100% 13.200 6.600 Y ANKRD20A1 n/a
4 TRCN0000157113 GAAGAGGCTTGTGCCGTTATT pLKO.1 2242 CDS 100% 13.200 6.600 Y ANKRD20A5P n/a
5 TRCN0000262909 ACTATGACTCACCAGGTATTG pLKO_005 2531 CDS 100% 10.800 5.400 Y ANKRD20A4 n/a
6 TRCN0000127485 CCACAGGTCAAAGAAGGAAAT pLKO.1 3055 CDS 100% 10.800 5.400 Y ANKRD20A2 n/a
7 TRCN0000432708 GATGCAGAAGATTATGCTATT pLKO_005 2608 CDS 100% 10.800 5.400 Y ANKRD20A1 n/a
8 TRCN0000262905 TGTGAAAGGAGCAGTACAAAG pLKO_005 2943 CDS 100% 10.800 5.400 Y ANKRD20A4 n/a
9 TRCN0000168216 CAAGTTCACATGCCGTTGATA pLKO.1 2477 CDS 100% 5.625 2.813 Y ANKRD20A1 n/a
10 TRCN0000155962 CTGTGAAAGGAGCAGTACAAA pLKO.1 2942 CDS 100% 5.625 2.813 Y ANKRD20A11P n/a
11 TRCN0000167295 CAGATTGATGTCTGTGACAAA pLKO.1 2182 CDS 100% 4.950 2.475 Y ANKRD20A1 n/a
12 TRCN0000128666 CCAATCCAAACCTTAAGGATA pLKO.1 2279 CDS 100% 4.950 2.475 Y ANKRD20A2 n/a
13 TRCN0000133759 CCAATCCAAACCTTAAGGATA pLKO.1 2279 CDS 100% 4.950 2.475 Y ANKRD20A3 n/a
14 TRCN0000138952 GCCGTTATTCTGCTGGAACAT pLKO.1 2254 CDS 100% 4.950 2.475 Y ANKRD20A3 n/a
15 TRCN0000138852 GCTCTCCATTATGCCGTGTAT pLKO.1 2314 CDS 100% 4.950 2.475 Y ANKRD20A3 n/a
16 TRCN0000172688 GCTGGCAGATTAACCCAACAA pLKO.1 3142 CDS 100% 4.950 2.475 Y ANKRD20A1 n/a
17 TRCN0000156881 GCTGTGAAAGGAGCAGTACAA pLKO.1 2941 CDS 100% 4.950 2.475 Y ANKRD20A11P n/a
18 TRCN0000134908 CCAGGTATTGTCAATATCCTT pLKO.1 2542 CDS 100% 3.000 1.500 Y ANKRD20A3 n/a
19 TRCN0000153376 GCCAATCCAAACCTTAAGGAT pLKO.1 2278 CDS 100% 3.000 1.500 Y ANKRD20A5P n/a
20 TRCN0000157682 CCTTTGATACAGGCTGTCCAT pLKO.1 2215 CDS 100% 2.640 1.320 Y ANKRD20A5P n/a
21 TRCN0000131073 GCCAGATTGATGTCTGTGACA pLKO.1 2180 CDS 100% 2.640 1.320 Y ANKRD20A2 n/a
22 TRCN0000137846 GTGTGGATTCATTGCCTGCAT pLKO.1 2750 CDS 100% 2.640 1.320 Y ANKRD20A3 n/a
23 TRCN0000156507 GTATAGTGAGAGCACCTCACT pLKO.1 2331 CDS 100% 0.264 0.132 Y ANKRD20A5P n/a
24 TRCN0000139212 CAGCACAGAACTGCTCTACAT pLKO.1 2104 CDS 100% 4.950 2.475 Y ANKRD20A19P n/a
25 TRCN0000158171 CCTTGAAGCCTAGCACTGAAA pLKO.1 2909 CDS 100% 4.950 2.475 Y ANKRD20A11P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543861.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13700 pDONR223 100% 53.8% 53.2% None (many diffs) n/a
2 ccsbBroad304_13700 pLX_304 0% 53.8% 53.2% V5 (many diffs) n/a
3 TRCN0000476704 CAATTCCTCTTAAGATTAAATCAT pLX_317 15.4% 53.8% 53.2% V5 (many diffs) n/a
4 ccsbBroadEn_13693 pDONR223 100% 35.1% 33.8% None (many diffs) n/a
5 ccsbBroadEn_13719 pDONR223 100% 29.6% 17% None (many diffs) n/a
6 ccsbBroad304_13719 pLX_304 0% 29.6% 17% V5 (many diffs) n/a
7 TRCN0000467491 ATCAGATGCCTACGAAGGCAGTTC pLX_317 93.9% 29.6% 17% V5 (many diffs) n/a
Download CSV