Transcript: Human XM_011544001.2

PREDICTED: Homo sapiens synaptotagmin like 5 (SYTL5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYTL5 (94122)
Length:
5144
CDS:
796..3054

Additional Resources:

NCBI RefSeq record:
XM_011544001.2
NBCI Gene record:
SYTL5 (94122)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380709 ATGATCCTGGGCGTCCTAAAG pLKO_005 853 CDS 100% 10.800 15.120 N SYTL5 n/a
2 TRCN0000381066 ATGTTGTCCGACAGTCCATTT pLKO_005 1205 CDS 100% 10.800 15.120 N SYTL5 n/a
3 TRCN0000379859 GGACTTAGACGGTCAACATTT pLKO_005 1431 CDS 100% 13.200 10.560 N SYTL5 n/a
4 TRCN0000381289 CCTTAGTGTCCTCGCAGTTAT pLKO_005 1892 CDS 100% 13.200 9.240 N SYTL5 n/a
5 TRCN0000382441 AGAGGATACTGTAAGCATAAG pLKO_005 1806 CDS 100% 10.800 7.560 N SYTL5 n/a
6 TRCN0000380196 GAAACACTAAAGTACACTATC pLKO_005 2284 CDS 100% 10.800 7.560 N SYTL5 n/a
7 TRCN0000010623 CGTTTCAAGCAAGTCAATGTT pLKO.1 1174 CDS 100% 5.625 3.938 N SYTL5 n/a
8 TRCN0000001464 GAGACTGAAGAAAGCATTGAT pLKO.1 1870 CDS 100% 5.625 3.938 N SYTL5 n/a
9 TRCN0000001465 AGTGTTCATCAAAGAGGCAAA pLKO.1 2631 CDS 100% 4.050 2.835 N SYTL5 n/a
10 TRCN0000001463 CACCAGAACAACTCCAAGGAA pLKO.1 2549 CDS 100% 3.000 2.100 N SYTL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04618 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04618 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491285 GAGCAAATTCGCCGCCAGCTTATA pLX_317 12.7% 100% 100% V5 n/a
4 TRCN0000488491 CCTAGTCTCTCTGTCATAGCATCC pLX_317 15.3% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV