Transcript: Human XM_011544111.1

PREDICTED: Homo sapiens consortin, connexin sorting protein (CNST), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNST (163882)
Length:
5260
CDS:
401..2578

Additional Resources:

NCBI RefSeq record:
XM_011544111.1
NBCI Gene record:
CNST (163882)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544111.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134667 GCATTGATTTCTGAGGGTAAA pLKO.1 1733 CDS 100% 10.800 15.120 N CNST n/a
2 TRCN0000136781 CCACATACAGTTACGGCTCTA pLKO.1 1127 CDS 100% 4.050 5.670 N CNST n/a
3 TRCN0000133884 CCAAGAAATAGACGATAGCTT pLKO.1 2344 CDS 100% 3.000 2.400 N CNST n/a
4 TRCN0000134732 GCAAACGCTTACACCTATTAT pLKO.1 3432 3UTR 100% 15.000 10.500 N CNST n/a
5 TRCN0000134886 CCTTATGGTTTCAGTGTCATT pLKO.1 3009 3UTR 100% 4.950 3.465 N CNST n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544111.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09755 pDONR223 100% 84.7% 84.4% None (many diffs) n/a
2 ccsbBroad304_09755 pLX_304 0% 84.7% 84.4% V5 (many diffs) n/a
3 TRCN0000466018 CTTTGGTCGGCTCTAATGATCAGA pLX_317 19.8% 84.7% 84.4% V5 (many diffs) n/a
4 ccsbBroadEn_16116 pDONR223 0% 34.9% 32.3% None (many diffs) n/a
5 ccsbBroad304_16116 pLX_304 0% 34.9% 32.3% V5 (many diffs) n/a
6 TRCN0000466742 TCGATAGTAACTATTTTGCCTAAT pLX_317 30.7% 34.9% 32.3% V5 (many diffs) n/a
Download CSV