Transcript: Human XM_011544836.2

PREDICTED: Homo sapiens DNA damage induced apoptosis suppressor (DDIAS), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DDIAS (220042)
Length:
3382
CDS:
62..3058

Additional Resources:

NCBI RefSeq record:
XM_011544836.2
NBCI Gene record:
DDIAS (220042)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544836.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145524 GAGTGACCATTCTAGTCTAAA pLKO.1 1759 CDS 100% 13.200 18.480 N DDIAS n/a
2 TRCN0000142019 GCCTATCATTTCCCTGATCAA pLKO.1 2732 CDS 100% 4.950 6.930 N DDIAS n/a
3 TRCN0000142345 CTTCAGTGTGTGAAACTCGAA pLKO.1 3009 CDS 100% 2.640 3.696 N DDIAS n/a
4 TRCN0000142020 GCCAGTAACTTCTTACAGCAA pLKO.1 488 CDS 100% 2.640 3.696 N DDIAS n/a
5 TRCN0000145237 GCACCTAACAATCACTTACTT pLKO.1 656 CDS 100% 5.625 4.500 N DDIAS n/a
6 TRCN0000121774 CGGAAAGCATTCTTTACATTT pLKO.1 3123 3UTR 100% 13.200 9.240 N DDIAS n/a
7 TRCN0000144068 CTTGGAGAGAAGCAAATTGAA pLKO.1 3150 3UTR 100% 5.625 3.938 N DDIAS n/a
8 TRCN0000139166 CCACCTTCGTTACTCAGACTT pLKO.1 1235 CDS 100% 4.950 3.465 N DDIAS n/a
9 TRCN0000142438 GAACACTTGGAGAGAAGCAAA pLKO.1 3145 3UTR 100% 4.950 3.465 N DDIAS n/a
10 TRCN0000121838 GCAGTTCTTGAAAGTGAGATT pLKO.1 1340 CDS 100% 4.950 3.465 N DDIAS n/a
11 TRCN0000143941 CTTGAAAGTGAGATTGCTGTA pLKO.1 1346 CDS 100% 4.050 2.835 N DDIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544836.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09858 pDONR223 100% 99.8% 99.6% None 650T>C;1380G>T;2524G>A n/a
2 ccsbBroad304_09858 pLX_304 0% 99.8% 99.6% V5 650T>C;1380G>T;2524G>A n/a
3 TRCN0000471382 GAATTTGAAATTTATAAATTCGGG pLX_317 1.5% 99.8% 99.6% V5 650T>C;1380G>T;2524G>A n/a
Download CSV