Transcript: Human XM_011545295.2

PREDICTED: Homo sapiens fermitin family member 3 (FERMT3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FERMT3 (83706)
Length:
2392
CDS:
535..1998

Additional Resources:

NCBI RefSeq record:
XM_011545295.2
NBCI Gene record:
FERMT3 (83706)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545295.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426436 GCCGAATTGTACACGAGTATA pLKO_005 1877 CDS 100% 13.200 18.480 N FERMT3 n/a
2 TRCN0000131235 GACTGGTCAGACCATGCTATT pLKO.1 166 5UTR 100% 10.800 15.120 N FERMT3 n/a
3 TRCN0000131137 GCATTAAACTCCTAGTGCCCT pLKO.1 1256 CDS 100% 0.660 0.924 N FERMT3 n/a
4 TRCN0000431404 GAGACCACACTGTCCTACTAC pLKO_005 1138 CDS 100% 4.950 3.960 N FERMT3 n/a
5 TRCN0000130949 CAAGGACCATCTCCGAATCTT pLKO.1 1050 CDS 100% 5.625 3.938 N FERMT3 n/a
6 TRCN0000129604 CCTGCAGTACCACATCAACAA pLKO.1 882 CDS 100% 4.950 3.465 N FERMT3 n/a
7 TRCN0000438252 CCTGCAGTACCACATCAACAA pLKO_005 882 CDS 100% 4.950 3.465 N Fermt3 n/a
8 TRCN0000127942 CTTCTTCGATTTGGATCCCAA pLKO.1 759 CDS 100% 2.640 1.848 N FERMT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545295.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09109 pDONR223 100% 72.3% 72.4% None 0_1ins540;189C>T;539_550del n/a
2 ccsbBroad304_09109 pLX_304 0% 72.3% 72.4% V5 0_1ins540;189C>T;539_550del n/a
3 TRCN0000491967 GGTTATATGCATCTGTGTACGGTC pLX_317 17.1% 72.3% 72.4% V5 0_1ins540;189C>T;539_550del n/a
Download CSV