Transcript: Human XM_011546152.1

PREDICTED: Homo sapiens solute carrier family 25 member 18 (SLC25A18), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC25A18 (83733)
Length:
1950
CDS:
354..1301

Additional Resources:

NCBI RefSeq record:
XM_011546152.1
NBCI Gene record:
SLC25A18 (83733)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011546152.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043953 CGAATCCAAACCCTCAAGAAA pLKO.1 1095 CDS 100% 5.625 7.875 N SLC25A18 n/a
2 TRCN0000043954 GCATGGGAAAGCCATGTACAA pLKO.1 470 CDS 100% 0.495 0.396 N SLC25A18 n/a
3 TRCN0000423617 ATGGTACTTTCGTTGTATTAA pLKO_005 1565 3UTR 100% 15.000 10.500 N SLC25A18 n/a
4 TRCN0000415733 GACCATCTGCCTTCATGAAAG pLKO_005 1180 CDS 100% 10.800 7.560 N SLC25A18 n/a
5 TRCN0000430652 GTTAATCTTGGACTCCATAAC pLKO_005 1695 3UTR 100% 10.800 7.560 N SLC25A18 n/a
6 TRCN0000043955 AGAGCGCATCTTAAAGTGTTT pLKO.1 1274 CDS 100% 4.950 3.465 N SLC25A18 n/a
7 TRCN0000043957 GCCACTCTCCTCAGAGACATT pLKO.1 915 CDS 100% 4.950 3.465 N SLC25A18 n/a
8 TRCN0000043956 TGTGCCAGGAAACTCTGGATT pLKO.1 1152 CDS 100% 4.950 2.970 N SLC25A18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011546152.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04293 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04293 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469151 TATCTCGATTCCAATCGGTCAGCC pLX_317 35.1% 100% 100% V5 n/a
4 TRCN0000488084 GCGCTGGTGGTCCTGCATCGCGTT pLX_317 31.1% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000488782 GAACCCAGATTCTCACCTGGCCTA pLX_317 33.8% 99.8% 99.6% V5 945_946insG n/a
Download CSV