Transcript: Human XM_017001317.1

PREDICTED: Homo sapiens LIM homeobox 8 (LHX8), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LHX8 (431707)
Length:
1195
CDS:
95..1186

Additional Resources:

NCBI RefSeq record:
XM_017001317.1
NBCI Gene record:
LHX8 (431707)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001317.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017394 CCCAAGATGGAACGATGTTAA pLKO.1 1014 CDS 100% 13.200 18.480 N LHX8 n/a
2 TRCN0000017393 CGTGTGATACAGGTGTGGTTT pLKO.1 863 CDS 100% 4.950 6.930 N LHX8 n/a
3 TRCN0000017397 GCGCTGCATAGTTATATGGAT pLKO.1 1037 CDS 100% 3.000 4.200 N LHX8 n/a
4 TRCN0000017396 GCACACCAGCTGTTATATTAA pLKO.1 397 CDS 100% 15.000 12.000 N LHX8 n/a
5 TRCN0000038950 GCAAGATGTTAACCATCCAAA pLKO.1 712 CDS 100% 4.950 3.465 N LHX8 n/a
6 TRCN0000038951 GCAAGTGTGTGTGCAACAGTT pLKO.1 276 CDS 100% 4.950 3.465 N LHX8 n/a
7 TRCN0000038953 CTTCAGGTTATGCAAGCACAA pLKO.1 773 CDS 100% 4.050 2.835 N LHX8 n/a
8 TRCN0000038952 CAGAGTACATTATGACTGCAT pLKO.1 622 CDS 100% 2.640 1.848 N LHX8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001317.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10157 pDONR223 100% 88.3% 86.4% None (many diffs) n/a
2 ccsbBroad304_10157 pLX_304 62.9% 88.3% 86.4% V5 (many diffs) n/a
3 TRCN0000465899 GAGAGTTCGCTCAGAAAAATCGGC pLX_317 30.8% 88.3% 86.4% V5 (many diffs) n/a
Download CSV