Transcript: Human XM_017001374.2

PREDICTED: Homo sapiens natriuretic peptide receptor 1 (NPR1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NPR1 (4881)
Length:
2644
CDS:
461..2575

Additional Resources:

NCBI RefSeq record:
XM_017001374.2
NBCI Gene record:
NPR1 (4881)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001374.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007329 GCTTTCAAGGTGTGACAGGAT pLKO.1 1623 CDS 100% 2.640 3.696 N NPR1 n/a
2 TRCN0000349578 GCTTTCAAGGTGTGACAGGAT pLKO_005 1623 CDS 100% 2.640 3.696 N NPR1 n/a
3 TRCN0000007327 CCCAGATAATCCCGAGTACTT pLKO.1 1408 CDS 100% 4.950 3.465 N NPR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001374.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488907 AGGCGTGCCGTTCCACTCACTATC pLX_317 11.4% 66.2% 65.9% V5 (many diffs) n/a
2 TRCN0000487819 TTAACACTCCCCGGCGCAGTGGAG pLX_317 7.8% 66.2% 65.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_13913 pDONR223 100% 66.1% 65.8% None (many diffs) n/a
4 ccsbBroad304_13913 pLX_304 0% 66.1% 65.8% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV