Transcript: Human XM_017002019.2

PREDICTED: Homo sapiens GC-rich promoter binding protein 1 like 1 (GPBP1L1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPBP1L1 (60313)
Length:
3474
CDS:
1265..2530

Additional Resources:

NCBI RefSeq record:
XM_017002019.2
NBCI Gene record:
GPBP1L1 (60313)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002019.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330090 GCCTGGAAGTAGGCATATAAA pLKO_005 2519 CDS 100% 15.000 21.000 N GPBP1L1 n/a
2 TRCN0000330089 ACCCTCCAAGATGCTAGTTAT pLKO_005 1837 CDS 100% 13.200 18.480 N GPBP1L1 n/a
3 TRCN0000146487 CAGTCCAATCTCTGTTACCAA pLKO.1 2083 CDS 100% 3.000 4.200 N GPBP1L1 n/a
4 TRCN0000330163 ACACATACACACCCAGTATAT pLKO_005 2775 3UTR 100% 13.200 9.240 N GPBP1L1 n/a
5 TRCN0000146336 CCATGCAAATGGGAACAAATT pLKO.1 1924 CDS 100% 13.200 9.240 N GPBP1L1 n/a
6 TRCN0000330087 CCATGCAAATGGGAACAAATT pLKO_005 1924 CDS 100% 13.200 9.240 N GPBP1L1 n/a
7 TRCN0000146766 CTCCAAGATGCTAGTTATCAA pLKO.1 1840 CDS 100% 5.625 3.938 N GPBP1L1 n/a
8 TRCN0000183228 GCAATCATTGTCAATGACAAA pLKO.1 2902 3UTR 100% 4.950 3.465 N GPBP1L1 n/a
9 TRCN0000150202 GCACAGGTTATTGAAAGCTAT pLKO.1 2269 CDS 100% 4.950 3.465 N GPBP1L1 n/a
10 TRCN0000330088 GCACAGGTTATTGAAAGCTAT pLKO_005 2269 CDS 100% 4.950 3.465 N GPBP1L1 n/a
11 TRCN0000217647 GAAGCAGAGCACAGGTTATTA pLKO.1 2261 CDS 100% 15.000 10.500 N Gpbp1l1 n/a
12 TRCN0000246905 GAAGCAGAGCACAGGTTATTA pLKO_005 2261 CDS 100% 15.000 10.500 N Gpbp1l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002019.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15955 pDONR223 0% 88.8% 88.8% None 885_886ins159 n/a
2 ccsbBroad304_15955 pLX_304 0% 88.8% 88.8% V5 885_886ins159 n/a
3 TRCN0000472053 GCGCGAGTGACTAACCTCTGGTAG pLX_317 39.3% 88.8% 88.8% V5 885_886ins159 n/a
4 ccsbBroadEn_08790 pDONR223 100% 88.6% 88.8% None 885_886ins159;1089A>G;1167T>C n/a
5 ccsbBroad304_08790 pLX_304 0% 88.6% 88.8% V5 885_886ins159;1089A>G;1167T>C n/a
6 TRCN0000473528 GTCTCTAGAACAGGACTCGGACGG pLX_317 39.1% 88.6% 88.8% V5 885_886ins159;1089A>G;1167T>C n/a
Download CSV