Transcript: Human XM_017002207.2

PREDICTED: Homo sapiens tyrosine kinase with immunoglobulin like and EGF like domains 1 (TIE1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TIE1 (7075)
Length:
3445
CDS:
119..2611

Additional Resources:

NCBI RefSeq record:
XM_017002207.2
NBCI Gene record:
TIE1 (7075)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379802 AGTGAGAACGTGACGTTAATG pLKO_005 1619 CDS 100% 13.200 18.480 N TIE1 n/a
2 TRCN0000381103 CCATGACGGCGAATGTGTATG pLKO_005 835 CDS 100% 10.800 15.120 N TIE1 n/a
3 TRCN0000121269 GCCAATATCCAAGTACGTTGT pLKO.1 2134 CDS 100% 4.050 5.670 N TIE1 n/a
4 TRCN0000199514 GCGCCTTCTTTCGGCTCATCG pLKO.1 732 CDS 100% 0.000 0.000 N TIE1 n/a
5 TRCN0000121188 GACTGGAGCAACACAGTAGAA pLKO.1 2297 CDS 100% 4.950 3.960 N TIE1 n/a
6 TRCN0000199821 GTGGCACTTGTGACCGGTTCA pLKO.1 1089 CDS 100% 1.350 1.080 N TIE1 n/a
7 TRCN0000307973 AGGTGACACCGCTGTACTTTC pLKO_005 532 CDS 100% 10.800 7.560 N TIE1 n/a
8 TRCN0000310098 CAGAACTGGAGTTCAACTTAG pLKO_005 1191 CDS 100% 10.800 7.560 N TIE1 n/a
9 TRCN0000001606 TGAGGCCAAAGACAGGATACA pLKO.1 1644 CDS 100% 4.950 3.465 N TIE1 n/a
10 TRCN0000121270 GCCTGAGGAGACAAGCACCAT pLKO.1 2209 CDS 100% 0.880 0.616 N TIE1 n/a
11 TRCN0000121268 GCCACGACCATGACGGCGAAT pLKO.1 828 CDS 100% 0.000 0.000 N TIE1 n/a
12 TRCN0000121114 CCAGTGAGAACGTGACGTTAA pLKO.1 1617 CDS 100% 10.800 6.480 N TIE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07068 pDONR223 100% 72.1% 70.5% None (many diffs) n/a
2 ccsbBroad304_07068 pLX_304 0% 72.1% 70.5% V5 (many diffs) n/a
3 ccsbBroadEn_14864 pDONR223 0% 72.2% 70.6% None (many diffs) n/a
4 ccsbBroad304_14864 pLX_304 0% 72.2% 70.6% V5 (many diffs) n/a
Download CSV