Transcript: Human XM_017003162.2

PREDICTED: Homo sapiens striated muscle enriched protein kinase (SPEG), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPEG (10290)
Length:
2980
CDS:
1669..2181

Additional Resources:

NCBI RefSeq record:
XM_017003162.2
NBCI Gene record:
SPEG (10290)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037431 CTACACTTGCAAAGCGGTCAA pLKO.1 2109 CDS 100% 4.050 5.670 N SPEG n/a
2 TRCN0000037432 GCGTGGCGATGCTGGTTTCTA pLKO.1 2091 CDS 100% 1.875 2.625 N SPEG n/a
3 TRCN0000037429 CCACCTTCAAGGTCTCACTTA pLKO.1 1898 CDS 100% 4.950 3.465 N SPEG n/a
4 TRCN0000037430 CCAAGATGTCATCATGAGCAT pLKO.1 1941 CDS 100% 2.640 1.848 N SPEG n/a
5 TRCN0000037433 TCACTTATGGACCAGTCAGTA pLKO.1 1912 CDS 100% 4.950 2.970 N SPEG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488863 GAAACGTACAGGTATTCTTTTTCG pLX_317 59.5% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000488546 TAATCTTAGTTCATACATGCTTTC pLX_317 58.7% 99.8% 99.4% V5 510_511insG n/a
3 ccsbBroadEn_02387 pDONR223 100% 66.4% 66.4% None 1_171del n/a
4 ccsbBroad304_02387 pLX_304 0% 66.4% 66.4% V5 1_171del n/a
5 TRCN0000467901 AATAATGACTCCTACGGATTTTGC pLX_317 77.9% 66.4% 66.4% V5 1_171del n/a
Download CSV