Transcript: Human XM_017003401.2

PREDICTED: Homo sapiens cAMP responsive element binding protein 1 (CREB1), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CREB1 (1385)
Length:
7211
CDS:
614..949

Additional Resources:

NCBI RefSeq record:
XM_017003401.2
NBCI Gene record:
CREB1 (1385)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003401.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226467 ACGGTGCCAACTCCAATTTAC pLKO_005 365 5UTR 100% 13.200 18.480 N CREB1 n/a
2 TRCN0000011085 CAGTGGATAGTGTAACTGATT pLKO.1 201 5UTR 100% 4.950 6.930 N CREB1 n/a
3 TRCN0000007308 GCTCGATAAATCTAACAGTTA pLKO.1 2352 3UTR 100% 4.950 6.930 N CREB1 n/a
4 TRCN0000007310 CGTCTAATGAAGAACAGGGAA pLKO.1 788 CDS 100% 2.640 3.696 N CREB1 n/a
5 TRCN0000226469 ACCAATCCCTTGAGTTATATA pLKO_005 1786 3UTR 100% 15.000 12.000 N CREB1 n/a
6 TRCN0000218546 ACGTACAAACATACCAGATTC pLKO_005 666 CDS 100% 10.800 8.640 N CREB1 n/a
7 TRCN0000226468 ACAGCACCCACTAGCACTATT pLKO_005 689 CDS 100% 13.200 9.240 N CREB1 n/a
8 TRCN0000378139 CAATACAGCTGGCTAACAATG pLKO_005 429 5UTR 100% 10.800 7.560 N CREB1 n/a
9 TRCN0000356000 GGAGTCAGTGGATAGTGTAAC pLKO_005 196 5UTR 100% 10.800 7.560 N CREB1 n/a
10 TRCN0000096629 GCCTGAAAGCAACTACAGAAT pLKO.1 1066 3UTR 100% 4.950 3.465 N Creb1 n/a
11 TRCN0000301658 GCCTGAAAGCAACTACAGAAT pLKO_005 1066 3UTR 100% 4.950 3.465 N Creb1 n/a
12 TRCN0000356046 GCCTGAAAGCAACTACAGAAT pLKO_005 1066 3UTR 100% 4.950 3.465 N CREB1 n/a
13 TRCN0000007309 GCAAACATTAACCATGACCAA pLKO.1 472 5UTR 100% 2.640 1.848 N CREB1 n/a
14 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2475 3UTR 100% 4.950 2.475 Y ERAP2 n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2476 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003401.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00360 pDONR223 100% 29.8% 29% None (many diffs) n/a
2 ccsbBroad304_00360 pLX_304 26.2% 29.8% 29% V5 (many diffs) n/a
3 TRCN0000475150 GGTGTGTATCCTCGACAATTCGGG pLX_317 58.1% 29.8% 29% V5 (many diffs) n/a
Download CSV