Transcript: Human XM_017003949.2

PREDICTED: Homo sapiens histamine N-methyltransferase (HNMT), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HNMT (3176)
Length:
1284
CDS:
87..572

Additional Resources:

NCBI RefSeq record:
XM_017003949.2
NBCI Gene record:
HNMT (3176)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003949.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036429 CCAGGCATAATAGGAAGGATT pLKO.1 207 CDS 100% 4.950 6.435 N HNMT n/a
2 TRCN0000036432 CGGGAAATATGTTGAATCTTT pLKO.1 122 CDS 100% 5.625 4.500 N HNMT n/a
3 TRCN0000036431 CCCAGGAGTTTGTATCAACAA pLKO.1 320 CDS 100% 4.950 3.465 N HNMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003949.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06386 pDONR223 100% 53.7% 48.3% None (many diffs) n/a
2 ccsbBroad304_06386 pLX_304 0% 53.7% 48.3% V5 (many diffs) n/a
3 TRCN0000473124 TTGAGCATGCCAGGCCTTCGGCCT pLX_317 46.6% 53.7% 48.3% V5 (many diffs) n/a
4 ccsbBroadEn_15448 pDONR223 0% 29.9% 28.5% None (many diffs) n/a
5 ccsbBroad304_15448 pLX_304 0% 29.9% 28.5% V5 (many diffs) n/a
6 TRCN0000473500 ATTCCCCAGCCCCATTGAGTCACT pLX_317 100% 29.9% 28.5% V5 (many diffs) n/a
Download CSV