Transcript: Human XM_017003984.1

PREDICTED: Homo sapiens cyclin dependent kinase like 4 (CDKL4), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDKL4 (344387)
Length:
2014
CDS:
1417..1980

Additional Resources:

NCBI RefSeq record:
XM_017003984.1
NBCI Gene record:
CDKL4 (344387)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003984.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358262 ACGTATGTTGAAGCAATTAAA pLKO_005 1572 CDS 100% 15.000 10.500 N CDKL4 n/a
2 TRCN0000021522 CTGAAGATGATCCTGTTGTTA pLKO.1 1529 CDS 100% 5.625 3.938 N CDKL4 n/a
3 TRCN0000195080 CCAAATCTTGTGAACCTCATC pLKO.1 1597 CDS 100% 4.050 2.835 N CDKL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003984.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467405 GCGTACAAATGTAGATCTTTTTCC pLX_317 30.2% 53.3% 35.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_15308 pDONR223 100% 53.2% 35.6% None (many diffs) n/a
3 ccsbBroad304_15308 pLX_304 0% 53.2% 35.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV