Transcript: Human XM_017004783.2

PREDICTED: Homo sapiens signal transducer and activator of transcription 1 (STAT1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STAT1 (6772)
Length:
4360
CDS:
388..2646

Additional Resources:

NCBI RefSeq record:
XM_017004783.2
NBCI Gene record:
STAT1 (6772)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004783.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004268 CCCAAAGTATCAGGACGAGAA pLKO.1 2912 3UTR 100% 4.050 5.670 N STAT1 n/a
2 TRCN0000280022 CCCAAAGTATCAGGACGAGAA pLKO_005 2912 3UTR 100% 4.050 5.670 N STAT1 n/a
3 TRCN0000004267 CTGGAAGATTTACAAGATGAA pLKO.1 880 CDS 100% 4.950 3.465 N STAT1 n/a
4 TRCN0000280021 CTGGAAGATTTACAAGATGAA pLKO_005 880 CDS 100% 4.950 3.465 N STAT1 n/a
5 TRCN0000004265 CCCTGAAGTATCTGTATCCAA pLKO.1 2381 CDS 100% 3.000 2.100 N STAT1 n/a
6 TRCN0000280024 CCCTGAAGTATCTGTATCCAA pLKO_005 2381 CDS 100% 3.000 2.100 N STAT1 n/a
7 TRCN0000004264 GAACAGAAATACACCTACGAA pLKO.1 1243 CDS 100% 3.000 2.100 N STAT1 n/a
8 TRCN0000004266 CGACAGTATGATGAACACAGT pLKO.1 2622 CDS 100% 2.640 1.848 N STAT1 n/a
9 TRCN0000280023 CGACAGTATGATGAACACAGT pLKO_005 2622 CDS 100% 2.640 1.848 N STAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004783.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01607 pDONR223 100% 94.6% 94.6% None 1_6delATGTGG;2142_2256delinsG n/a
2 ccsbBroad304_01607 pLX_304 28.1% 94.6% 94.6% V5 1_6delATGTGG;2142_2256delinsG n/a
3 TRCN0000472828 GCACTTCAACGCACACGCCCATTC pLX_317 14.2% 94.6% 94.6% V5 1_6delATGTGG;2142_2256delinsG n/a
Download CSV