Transcript: Human XM_017005339.2

PREDICTED: Homo sapiens transforming growth factor beta receptor associated protein 1 (TGFBRAP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TGFBRAP1 (9392)
Length:
5358
CDS:
1043..2365

Additional Resources:

NCBI RefSeq record:
XM_017005339.2
NBCI Gene record:
TGFBRAP1 (9392)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005339.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364506 ACTTGGACTGCTCTATCATTA pLKO_005 1255 CDS 100% 13.200 18.480 N TGFBRAP1 n/a
2 TRCN0000369064 TTCCGTCCATACGCAACAAGG pLKO_005 2492 3UTR 100% 4.050 5.670 N TGFBRAP1 n/a
3 TRCN0000005764 CGGAGGAACATTCCAAAGGAA pLKO.1 772 5UTR 100% 3.000 2.400 N TGFBRAP1 n/a
4 TRCN0000005762 GCTCCAGAAATCTGATTTATA pLKO.1 1714 CDS 100% 15.000 10.500 N TGFBRAP1 n/a
5 TRCN0000376408 TCTGCAGCAGGCGGGATTTAT pLKO_005 819 5UTR 100% 15.000 10.500 N TGFBRAP1 n/a
6 TRCN0000376407 CGCAGCACAGAGGTAGCAAAT pLKO_005 1088 CDS 100% 10.800 7.560 N TGFBRAP1 n/a
7 TRCN0000369122 GCATGAGAAGGCGCTGCATAT pLKO_005 1816 CDS 100% 10.800 7.560 N TGFBRAP1 n/a
8 TRCN0000369121 GTATGAATACATCGTGGATTT pLKO_005 1357 CDS 100% 10.800 7.560 N TGFBRAP1 n/a
9 TRCN0000005765 CTACGATAAGATGAAGTTGAA pLKO.1 2179 CDS 100% 4.950 3.465 N TGFBRAP1 n/a
10 TRCN0000005763 GCCCTTGTGAAGTATCTGGAA pLKO.1 1547 CDS 100% 2.640 1.848 N TGFBRAP1 n/a
11 TRCN0000005761 CGAGTTCTTTCTGAGCCTGCT pLKO.1 2397 3UTR 100% 2.160 1.512 N TGFBRAP1 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4517 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4517 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005339.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07408 pDONR223 100% 51.1% 51.1% None 0_1ins1260 n/a
2 ccsbBroad304_07408 pLX_304 0% 51.1% 51.1% V5 0_1ins1260 n/a
3 TRCN0000466541 ACCCTTTCAGGCTTCGACCGAGTT pLX_317 12.2% 51.1% 51.1% V5 0_1ins1260 n/a
Download CSV