Transcript: Human XM_017005522.1

PREDICTED: Homo sapiens CD96 molecule (CD96), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CD96 (10225)
Length:
4017
CDS:
132..1577

Additional Resources:

NCBI RefSeq record:
XM_017005522.1
NBCI Gene record:
CD96 (10225)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230303 AGTGGAAGGTACGAGTGTATG pLKO_005 468 CDS 100% 10.800 15.120 N CD96 n/a
2 TRCN0000218889 TGTCAAGGAACTAAGGTATTT pLKO_005 3701 3UTR 100% 13.200 10.560 N CD96 n/a
3 TRCN0000218594 ACATAGCGACAGATAACTATA pLKO_005 3951 3UTR 100% 13.200 9.240 N CD96 n/a
4 TRCN0000230304 ACGTCCATATCACTGGTATTG pLKO_005 1330 CDS 100% 10.800 7.560 N CD96 n/a
5 TRCN0000057684 CCAGTGATTGTAGCAGCTTTA pLKO.1 1383 CDS 100% 10.800 7.560 N CD96 n/a
6 TRCN0000057683 CCTGCTTACTAAAGAATGTAT pLKO.1 685 CDS 100% 5.625 3.938 N CD96 n/a
7 TRCN0000057687 CCAACGAAAGTGATCTGCCTT pLKO.1 1534 CDS 100% 2.640 1.848 N CD96 n/a
8 TRCN0000057685 CCCAGGAAATAAAGTGTGGAA pLKO.1 902 CDS 100% 2.640 1.848 N CD96 n/a
9 TRCN0000057686 CCTGTGAGTCACTTGTGACTT pLKO.1 382 CDS 100% 0.495 0.347 N CD96 n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3391 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3392 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11472 pDONR223 100% 54.4% 53.1% None (many diffs) n/a
2 ccsbBroad304_11472 pLX_304 0% 54.4% 53.1% V5 (many diffs) n/a
3 TRCN0000471161 GATCATACTATATTTAACTTTTTA pLX_317 37.6% 54.4% 53.1% V5 (many diffs) n/a
Download CSV