Transcript: Human XM_017005823.2

PREDICTED: Homo sapiens discs large MAGUK scaffold protein 1 (DLG1), transcript variant X29, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DLG1 (1739)
Length:
7218
CDS:
2730..5162

Additional Resources:

NCBI RefSeq record:
XM_017005823.2
NBCI Gene record:
DLG1 (1739)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145356 GGAGGTGCAGCACATAAGGA pXPR_003 TGG 734 30% 6 0.6152 DLG1 DLG1 76619
2 BRDN0001148200 TATGCTAACAGACTTACAGT pXPR_003 TGG 916 38% 7 0.5859 DLG1 DLG1 76617
3 BRDN0001147622 TTGAGTCATCTCCAATGTGT pXPR_003 GGG 389 16% 4 0.0343 DLG1 DLG1 76620
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005823.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006101 CGGGTCAATGACTGTATATTA pLKO.1 3192 CDS 100% 15.000 21.000 N DLG1 n/a
2 TRCN0000318827 CGGGTCAATGACTGTATATTA pLKO_005 3192 CDS 100% 15.000 21.000 N DLG1 n/a
3 TRCN0000006104 CCTATGAAAGACAGGATAAAT pLKO.1 4611 CDS 100% 15.000 12.000 N DLG1 n/a
4 TRCN0000006103 GCAGTGAATAACGTATGTTTA pLKO.1 3498 CDS 100% 13.200 9.240 N DLG1 n/a
5 TRCN0000318828 GCAGTGAATAACGTATGTTTA pLKO_005 3498 CDS 100% 13.200 9.240 N DLG1 n/a
6 TRCN0000006102 CCCACAAGTATGTATATGAAT pLKO.1 3594 CDS 100% 5.625 3.938 N DLG1 n/a
7 TRCN0000318830 CCCACAAGTATGTATATGAAT pLKO_005 3594 CDS 100% 5.625 3.938 N DLG1 n/a
8 TRCN0000006105 GCACAGATGCAGATTATGAAT pLKO.1 3025 CDS 100% 5.625 3.938 N DLG1 n/a
9 TRCN0000318762 GCACAGATGCAGATTATGAAT pLKO_005 3025 CDS 100% 5.625 3.938 N DLG1 n/a
10 TRCN0000025405 CCAGTGAATCAACAAGAAGTT pLKO.1 4560 CDS 100% 4.950 3.465 N Dlg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005823.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14615 pDONR223 52.1% 84.8% 5.7% None (many diffs) n/a
2 ccsbBroad304_14615 pLX_304 0% 84.8% 5.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000471116 TTCGAAGCCCGGCTAAACTAAATC pLX_317 13.6% 84.8% 5.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV