Transcript: Human XM_017005844.2

PREDICTED: Homo sapiens ALG1 chitobiosyldiphosphodolichol beta-mannosyltransferase like (ALG1L), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALG1L (200810)
Length:
5753
CDS:
5047..5673

Additional Resources:

NCBI RefSeq record:
XM_017005844.2
NBCI Gene record:
ALG1L (200810)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005844.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035819 CCCTTTGGTTATGGACATACA pLKO.1 5568 CDS 100% 4.950 2.970 N ALG1L n/a
2 TRCN0000035822 CCTTCTCTTGTCTGTGTGATA pLKO.1 5242 CDS 100% 4.950 2.970 N ALG1L n/a
3 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 753 5UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
4 TRCN0000036014 CAAGCCGGCATCTTTCTTTAA pLKO.1 4992 5UTR 100% 13.200 6.600 Y LOC402458 n/a
5 TRCN0000035124 GCCGTGAACTTCAAGTGTTTA pLKO.1 5368 CDS 100% 13.200 6.600 Y ALG1L6P n/a
6 TRCN0000262804 CCGTGAACTTCAAGTGTTTAC pLKO_005 5369 CDS 100% 10.800 5.400 Y ALG1L2 n/a
7 TRCN0000035128 AGCTGGTGAAACATGAAGAAA pLKO.1 5393 CDS 100% 5.625 2.813 Y ALG1L6P n/a
8 TRCN0000035821 GCAGGCAAGCTAAACCAGTTT pLKO.1 5485 CDS 100% 4.950 2.475 Y ALG1L n/a
9 TRCN0000035820 TGGACAGAGTTTGAACAACTT pLKO.1 5200 CDS 100% 4.950 2.475 Y ALG1L n/a
10 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 695 5UTR 100% 4.950 2.475 Y C16orf89 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005844.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09808 pDONR223 100% 89.7% 89.4% None 1_60del;218_220delCAG;466A>G n/a
2 ccsbBroad304_09808 pLX_304 0% 89.7% 89.4% V5 1_60del;218_220delCAG;466A>G n/a
3 TRCN0000473899 GTAAGTGAACCTTCGCATAACGTG pLX_317 73.6% 89.7% 89.4% V5 1_60del;218_220delCAG;466A>G n/a
4 ccsbBroadEn_08617 pDONR223 100% 34.6% 32.5% None (many diffs) n/a
5 ccsbBroad304_08617 pLX_304 0% 34.6% 32.5% V5 (many diffs) n/a
6 TRCN0000474781 GTTGTCATAGGATTGTCCTTGGGT pLX_317 41.7% 34.6% 32.5% V5 (many diffs) n/a
Download CSV