Transcript: Human XM_017006135.1

PREDICTED: Homo sapiens leucine rich repeats and immunoglobulin like domains 1 (LRIG1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRIG1 (26018)
Length:
4085
CDS:
16..2619

Additional Resources:

NCBI RefSeq record:
XM_017006135.1
NBCI Gene record:
LRIG1 (26018)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006135.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222555 GCAAGGACATCCGGTTTACAT pLKO.1 863 CDS 100% 5.625 7.875 N LRIG1 n/a
2 TRCN0000073437 CCCTTTCTGACCGACAAGAAA pLKO.1 1880 CDS 100% 0.563 0.788 N LRIG1 n/a
3 TRCN0000289919 CCCTTTCTGACCGACAAGAAA pLKO_005 1880 CDS 100% 0.563 0.788 N LRIG1 n/a
4 TRCN0000296403 TAACGCATGGCTGGAATTTAT pLKO_005 2994 3UTR 100% 15.000 10.500 N LRIG1 n/a
5 TRCN0000310218 ATCTGGACCATAACGAGATTT pLKO_005 419 CDS 100% 13.200 9.240 N LRIG1 n/a
6 TRCN0000073433 GCCGGTTCTATTTCAGCTAAT pLKO.1 1369 CDS 100% 10.800 7.560 N LRIG1 n/a
7 TRCN0000289844 GCCGGTTCTATTTCAGCTAAT pLKO_005 1369 CDS 100% 10.800 7.560 N LRIG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006135.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11799 pDONR223 100% 72.3% 69.6% None (many diffs) n/a
2 ccsbBroad304_11799 pLX_304 0% 72.3% 69.6% V5 (many diffs) n/a
3 TRCN0000481410 TTTTGTCCGACGATTTGCACCGCT pLX_317 14% 72.3% 69.6% V5 (many diffs) n/a
Download CSV