Transcript: Human XM_017006615.1

PREDICTED: Homo sapiens 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 (PFKFB4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PFKFB4 (5210)
Length:
3552
CDS:
98..1489

Additional Resources:

NCBI RefSeq record:
XM_017006615.1
NBCI Gene record:
PFKFB4 (5210)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149495 TCATGAGGTAATATACGATG pXPR_003 CGG 800 57% 9 1.0498 PFKFB4 PFKFB4 77123
2 BRDN0001147229 TGTCGCGGTTGACATAGTCA pXPR_003 GGG 620 45% 8 0.8172 PFKFB4 PFKFB4 77122
3 BRDN0001146962 GTCCTCATCTAGCGACTCGT pXPR_003 AGG 694 50% 8 0.6006 PFKFB4 PFKFB4 77124
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006615.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423212 CTCCTACGAGTCGCTAGATGA pLKO_005 784 CDS 100% 4.950 6.930 N PFKFB4 n/a
2 TRCN0000428775 GAGGCGCATTGAGTGCTATGA pLKO_005 760 CDS 100% 4.950 6.930 N PFKFB4 n/a
3 TRCN0000037764 GCCAACATCGTGCAAGTGAAA pLKO.1 683 CDS 100% 4.950 6.930 N PFKFB4 n/a
4 TRCN0000037767 CCGCATCGTATATTACCTCAT pLKO.1 892 CDS 100% 4.050 5.670 N PFKFB4 n/a
5 TRCN0000199820 GCGCAGCTCTTAGGTGTTCAC pLKO.1 1768 3UTR 100% 1.350 1.890 N PFKFB4 n/a
6 TRCN0000199335 CCGACAATGAAGAGGGCCTGA pLKO.1 465 CDS 100% 0.720 1.008 N PFKFB4 n/a
7 TRCN0000434350 CCAACTGCCCAACTCTCATTG pLKO_005 291 CDS 100% 10.800 7.560 N PFKFB4 n/a
8 TRCN0000199909 GCTGATTGGCTGCCACATTTC pLKO.1 3403 3UTR 100% 10.800 7.560 N PFKFB4 n/a
9 TRCN0000195584 CAAGAGTCTAGCCCAGTTCAT pLKO.1 1030 CDS 100% 4.950 3.465 N PFKFB4 n/a
10 TRCN0000196609 GAGAACAGAATGGCTACAAGA pLKO.1 618 CDS 100% 4.950 3.465 N PFKFB4 n/a
11 TRCN0000199385 CCTCAGAACGTGGACATCTCA pLKO.1 1424 CDS 100% 3.000 2.100 N PFKFB4 n/a
12 TRCN0000199612 GCACTGGGTGTGCCCTATGAA pLKO.1 1121 CDS 100% 1.875 1.313 N PFKFB4 n/a
13 TRCN0000199852 GCTGGCCTACTTCCTCGACAA pLKO.1 1273 CDS 100% 1.350 0.945 N PFKFB4 n/a
14 TRCN0000197279 GATAGGGACCTGTCCTATATC pLKO.1 812 CDS 100% 1.320 0.924 N PFKFB4 n/a
15 TRCN0000037766 CCTGTGGCATATGGTTGTAAA pLKO.1 1352 CDS 100% 0.000 0.000 N PFKFB4 n/a
16 TRCN0000037768 GACGTGGTCAAGACCTACAAA pLKO.1 425 CDS 100% 5.625 3.375 N PFKFB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006615.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.