Transcript: Human XM_017007106.1

PREDICTED: Homo sapiens transforming growth factor beta receptor 2 (TGFBR2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TGFBR2 (7048)
Length:
5843
CDS:
1702..3300

Additional Resources:

NCBI RefSeq record:
XM_017007106.1
NBCI Gene record:
TGFBR2 (7048)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007106.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010444 CAACAACGGTGCAGTCAAGTT pLKO.1 1716 CDS 100% 4.950 6.930 N TGFBR2 n/a
2 TRCN0000195606 CGACATGATAGTCACTGACAA pLKO.1 1698 5UTR 100% 4.950 3.960 N TGFBR2 n/a
3 TRCN0000294602 CTCAGGAAATGAGATTGATTT pLKO_005 3526 3UTR 100% 13.200 9.240 N Tgfbr2 n/a
4 TRCN0000197056 GACCTCAAGAGCTCCAATATC pLKO.1 2731 CDS 100% 13.200 9.240 N TGFBR2 n/a
5 TRCN0000197031 GCAGTCATTCTCTGGGTATAT pLKO.1 4735 3UTR 100% 13.200 9.240 N TGFBR2 n/a
6 TRCN0000196997 GCTTCTCCAAAGTGCATTATG pLKO.1 1945 CDS 100% 13.200 9.240 N TGFBR2 n/a
7 TRCN0000000833 GTCGCTTTGCTGAGGTCTATA pLKO.1 2354 CDS 100% 13.200 9.240 N TGFBR2 n/a
8 TRCN0000195083 CCATCTTTAATACCTTGAATG pLKO.1 4073 3UTR 100% 10.800 7.560 N TGFBR2 n/a
9 TRCN0000000834 CTTCTACTGCTACCGCGTTAA pLKO.1 2151 CDS 100% 10.800 7.560 N TGFBR2 n/a
10 TRCN0000000830 GCTCCCTAAACACTACCAAAT pLKO.1 3278 CDS 100% 10.800 7.560 N TGFBR2 n/a
11 TRCN0000000831 GAAGAATATAACACCAGCAAT pLKO.1 2047 CDS 100% 4.950 3.465 N TGFBR2 n/a
12 TRCN0000040012 GCCTGGTGAGACTTTCTTCAT pLKO.1 1980 CDS 100% 4.950 3.465 N TGFBR2 n/a
13 TRCN0000040009 GCAAGATACATGGCTCCAGAA pLKO.1 2860 CDS 100% 4.050 2.835 N TGFBR2 n/a
14 TRCN0000010445 GAATGACGAGAACATAACACT pLKO.1 1866 CDS 100% 3.000 2.100 N TGFBR2 n/a
15 TRCN0000010446 GAGTATGCCTCTTGGAAGACA pLKO.1 2443 CDS 100% 3.000 2.100 N TGFBR2 n/a
16 TRCN0000040008 CCTGACTTGTTGCTAGTCATA pLKO.1 2068 CDS 100% 0.495 0.347 N TGFBR2 n/a
17 TRCN0000194992 CTCTAGGCTTTATCGTGTTTA pLKO.1 4275 3UTR 100% 13.200 7.920 N TGFBR2 n/a
18 TRCN0000000832 TGTGGCTGTATGGAGAAAGAA pLKO.1 1848 CDS 100% 5.625 3.375 N TGFBR2 n/a
19 TRCN0000040011 GCAGAACACTTCAGAGCAGTT pLKO.1 2388 CDS 100% 4.050 2.430 N TGFBR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007106.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489077 ATGGGGTGCATTTCCAGAGTCGCA pLX_317 20.9% 93.8% 93.8% V5 (not translated due to prior stop codon) 0_1ins105 n/a
2 ccsbBroadEn_11186 pDONR223 100% 52.7% 52.7% None 0_1ins105;898_1596del n/a
3 TRCN0000470099 GTCCATCCAGGGGTTAGCCTACAT pLX_317 45% 52.7% 52.7% V5 0_1ins105;898_1596del n/a
4 ccsbBroad304_11186 pLX_304 66.1% 52.7% 16.4% V5 (not translated due to prior stop codon) 0_1ins105;268_269insA;898_1596del n/a
5 ccsbBroadEn_14862 pDONR223 0% 52.7% 52.7% None 0_1ins105;898_1596del n/a
6 ccsbBroad304_14862 pLX_304 58.8% 52.7% 52.7% V5 0_1ins105;898_1596del n/a
7 TRCN0000468246 TGACCAATAAAAGCAATAGGGCAC pLX_317 32.6% 52.7% 52.7% V5 0_1ins105;898_1596del n/a
Download CSV