Transcript: Human XM_017007979.2

PREDICTED: Homo sapiens zinc finger protein 718 (ZNF718), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF718 (255403)
Length:
6310
CDS:
2437..3777

Additional Resources:

NCBI RefSeq record:
XM_017007979.2
NBCI Gene record:
ZNF718 (255403)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007979.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161124 GTGTTTGCAAACCTGCATAAT pLKO.1 3556 CDS 100% 13.200 9.240 N ZNF718 n/a
2 TRCN0000158538 CCTCAACCCTTAATTTACATA pLKO.1 3140 CDS 100% 5.625 3.938 N ZNF718 n/a
3 TRCN0000162253 CCTCAGACTTTGCTAAACATA pLKO.1 3308 CDS 100% 5.625 3.375 N ZNF718 n/a
4 TRCN0000239639 CAGGAGAGAAACCCTACAAAT pLKO_005 3341 CDS 100% 13.200 6.600 Y Zfp992 n/a
5 TRCN0000164124 CTGGAGAGAAACCCTACATAT pLKO.1 3089 CDS 100% 13.200 6.600 Y ZNF718 n/a
6 TRCN0000159583 CCCTTAATGAACATAAGAGAA pLKO.1 3230 CDS 100% 4.950 2.475 Y ZNF718 n/a
7 TRCN0000284648 ATACAGGAGAGAAACCCTATA pLKO_005 3338 CDS 100% 10.800 5.400 Y Gm14308 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5100 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 4968 3UTR 100% 2.640 1.320 Y LINC01098 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5100 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007979.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09908 pDONR223 100% 93.3% 93.3% None 0_1ins96 n/a
2 ccsbBroad304_09908 pLX_304 0% 93.3% 93.3% V5 0_1ins96 n/a
3 TRCN0000468927 GCAAGGCCTCGTTTGTGTGCGGAG pLX_317 29.2% 93.3% 93.3% V5 0_1ins96 n/a
4 ccsbBroadEn_13469 pDONR223 100% 11.6% 9% None (many diffs) n/a
5 ccsbBroad304_13469 pLX_304 0% 11.6% 9% V5 (many diffs) n/a
6 TRCN0000469082 CACTTTTCAGCTCGAAATTAAATC pLX_317 100% 11.6% 9% V5 (many diffs) n/a
Download CSV