Transcript: Human XM_017008376.1

PREDICTED: Homo sapiens serine/threonine kinase 32B (STK32B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STK32B (55351)
Length:
868
CDS:
90..779

Additional Resources:

NCBI RefSeq record:
XM_017008376.1
NBCI Gene record:
STK32B (55351)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008376.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002272 GACTTCAACATAGCGACGGTA pLKO.1 438 CDS 100% 2.640 3.696 N STK32B n/a
2 TRCN0000002274 CAGAAGCGAGACACTAAGAAA pLKO.1 69 5UTR 100% 5.625 3.938 N STK32B n/a
3 TRCN0000342543 CAGAAGCGAGACACTAAGAAA pLKO_005 69 5UTR 100% 5.625 3.938 N STK32B n/a
4 TRCN0000002276 CGGTAGTGAAAGGAGCAGAAA pLKO.1 454 CDS 100% 4.950 3.465 N STK32B n/a
5 TRCN0000197258 GAAGTATTCCAGGTGTACATG pLKO.1 516 CDS 100% 4.950 3.465 N STK32B n/a
6 TRCN0000197109 GCAGCAGAATGTGCATTTCAC pLKO.1 284 CDS 100% 4.950 3.465 N STK32B n/a
7 TRCN0000342549 GCAGCAGAATGTGCATTTCAC pLKO_005 284 CDS 100% 4.950 3.465 N STK32B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008376.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491984 CTTCATGATGTGTCTAATTTGTTC pLX_317 24.5% 49.8% 42.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_08529 pDONR223 100% 49.8% 42.5% None (many diffs) n/a
3 ccsbBroad304_08529 pLX_304 0% 49.8% 42.5% V5 (many diffs) n/a
4 ccsbBroadEn_15096 pDONR223 0% 49.8% 42.5% None (many diffs) n/a
5 ccsbBroad304_15096 pLX_304 0% 49.8% 42.5% V5 (many diffs) n/a
Download CSV