Transcript: Human XM_017008776.1

PREDICTED: Homo sapiens ligand of numb-protein X 1 (LNX1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LNX1 (84708)
Length:
5334
CDS:
505..2691

Additional Resources:

NCBI RefSeq record:
XM_017008776.1
NBCI Gene record:
LNX1 (84708)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008776.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073124 CGGTGCTTGTATAACTGTAAA pLKO.1 2395 CDS 100% 13.200 18.480 N LNX1 n/a
2 TRCN0000423425 CATCCTCGATAGTACTCAAAG pLKO_005 2249 CDS 100% 10.800 15.120 N LNX1 n/a
3 TRCN0000412999 GTCATGAGAAGGTGGTAAATA pLKO_005 2012 CDS 100% 15.000 12.000 N LNX1 n/a
4 TRCN0000416624 CCCACTGGTCCATATCATTAT pLKO_005 1392 CDS 100% 13.200 9.240 N LNX1 n/a
5 TRCN0000073126 CCTTTGAGAGATCCACTATTA pLKO.1 1133 CDS 100% 13.200 9.240 N LNX1 n/a
6 TRCN0000073127 GCCAGGAGACATCATTCTAAA pLKO.1 1461 CDS 100% 13.200 9.240 N LNX1 n/a
7 TRCN0000428755 ATGGACATGATCTTCGATATG pLKO_005 1802 CDS 100% 10.800 7.560 N LNX1 n/a
8 TRCN0000073125 CCACTATTAGAAGCAGATCAT pLKO.1 1145 CDS 100% 4.950 3.465 N LNX1 n/a
9 TRCN0000073123 GCCTCCTAGAAACTACACTAT pLKO.1 3506 3UTR 100% 4.950 3.465 N LNX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008776.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04419 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04419 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470105 CTACATTACTGCATGCACCGCTGG pLX_317 15.9% 100% 100% V5 n/a
4 TRCN0000468085 GTAGCGTAAGCGATGTAGCCATGT pLX_317 23.5% 85.4% 83.1% V5 (many diffs) n/a
5 ccsbBroadEn_10472 pDONR223 100% 85.2% 82.8% None (many diffs) n/a
6 ccsbBroad304_10472 pLX_304 0% 85.2% 82.8% V5 (many diffs) n/a
Download CSV