Transcript: Human XM_017009111.2

PREDICTED: Homo sapiens serum response factor binding protein 1 (SRFBP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRFBP1 (153443)
Length:
1455
CDS:
41..1156

Additional Resources:

NCBI RefSeq record:
XM_017009111.2
NBCI Gene record:
SRFBP1 (153443)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009111.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166862 CCACTCTTTATCTGGATCTAA pLKO.1 1075 CDS 100% 5.625 7.875 N SRFBP1 n/a
2 TRCN0000412453 GACCTAAAGCAGTGACTATTG pLKO_005 621 CDS 100% 10.800 8.640 N SRFBP1 n/a
3 TRCN0000175787 GCCATGAAGGAATTGAAACCT pLKO.1 230 CDS 100% 3.000 2.400 N Srfbp1 n/a
4 TRCN0000415391 GCGAAGAAACCAATACATAAT pLKO_005 569 CDS 100% 13.200 9.240 N SRFBP1 n/a
5 TRCN0000416465 AGAAACCAGAAAGTTAGAATC pLKO_005 1045 CDS 100% 10.800 7.560 N SRFBP1 n/a
6 TRCN0000436553 AGTTGTCATTCTTCAGTTAAG pLKO_005 935 CDS 100% 10.800 7.560 N SRFBP1 n/a
7 TRCN0000417687 ATTGAAACCTGACATAGTAAC pLKO_005 241 CDS 100% 10.800 7.560 N SRFBP1 n/a
8 TRCN0000412298 GCGGTGACGACTTCTTCATTG pLKO_005 882 CDS 100% 10.800 7.560 N SRFBP1 n/a
9 TRCN0000413390 AGTCAGACGGACACGAAAGAA pLKO_005 907 CDS 100% 5.625 3.938 N SRFBP1 n/a
10 TRCN0000168126 GCGCAAAGATTGCTTGAAGAA pLKO.1 203 CDS 100% 4.950 3.465 N SRFBP1 n/a
11 TRCN0000434342 ATCTGCTCTTGGTGATGATAT pLKO_005 265 CDS 100% 13.200 7.920 N SRFBP1 n/a
12 TRCN0000168057 CCAGATTCTACTGCAACTGAA pLKO.1 311 CDS 100% 4.950 2.970 N SRFBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009111.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05072 pDONR223 100% 86.2% 85.7% None 1106G>A;1108_1108delAinsTTTCCAC;1113_1113delAins169 n/a
2 ccsbBroad304_05072 pLX_304 0% 86.2% 85.7% V5 1106G>A;1108_1108delAinsTTTCCAC;1113_1113delAins169 n/a
3 TRCN0000479070 ATAGCAAAATGTTACTTACTCAGG pLX_317 30.2% 86.2% 85.7% V5 1106G>A;1108_1108delAinsTTTCCAC;1113_1113delAins169 n/a
Download CSV