Transcript: Human XM_017009649.2

PREDICTED: Homo sapiens CDC42 small effector 2 (CDC42SE2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDC42SE2 (56990)
Length:
3515
CDS:
400..654

Additional Resources:

NCBI RefSeq record:
XM_017009649.2
NBCI Gene record:
CDC42SE2 (56990)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009649.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037629 GCGGATTGACAGAAGTATGAT pLKO.1 465 CDS 100% 5.625 7.875 N CDC42SE2 n/a
2 TRCN0000414500 AGTCCAAGGGAGGTTATGGAG pLKO_005 581 CDS 100% 2.640 2.112 N CDC42SE2 n/a
3 TRCN0000416027 TCCACCCTGTCGTGATTATTC pLKO_005 779 3UTR 100% 13.200 9.240 N CDC42SE2 n/a
4 TRCN0000424973 TAGCTCCATTCAGAACCAAAT pLKO_005 558 CDS 100% 10.800 7.560 N CDC42SE2 n/a
5 TRCN0000415686 TGTCAGACGAATCCTGCATTT pLKO_005 836 3UTR 100% 10.800 7.560 N CDC42SE2 n/a
6 TRCN0000417282 GGAGACCTGTTCAGTGGAATG pLKO_005 529 CDS 100% 6.000 4.200 N CDC42SE2 n/a
7 TRCN0000037633 GACGGCGGATTGACAGAAGTA pLKO.1 461 CDS 100% 4.950 3.465 N CDC42SE2 n/a
8 TRCN0000037631 GTATGATTGGAGAGCCCACAA pLKO.1 479 CDS 100% 4.050 2.835 N CDC42SE2 n/a
9 TRCN0000037630 GAGCCCACAAACTTTGTGCAT pLKO.1 490 CDS 100% 2.640 1.848 N CDC42SE2 n/a
10 TRCN0000037632 TGCTGTATTGCAGAACAGCCT pLKO.1 427 CDS 100% 0.066 0.046 N CDC42SE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009649.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03766 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03766 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466294 TGCATTCGATCGACAGGTTTTAAA pLX_317 100% 100% 100% V5 n/a
Download CSV