Transcript: Human XM_017010237.1

PREDICTED: Homo sapiens solute carrier family 16 member 10 (SLC16A10), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC16A10 (117247)
Length:
6718
CDS:
1002..1829

Additional Resources:

NCBI RefSeq record:
XM_017010237.1
NBCI Gene record:
SLC16A10 (117247)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010237.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038534 GCAGGGTTACTTCGTGACAAA pLKO.1 1593 CDS 100% 4.950 6.930 N SLC16A10 n/a
2 TRCN0000271404 CTTACCTATGGAATCATATTT pLKO_005 789 5UTR 100% 15.000 12.000 N SLC16A10 n/a
3 TRCN0000271341 GAAAGAATCTGACTCTATTAT pLKO_005 1805 CDS 100% 15.000 10.500 N SLC16A10 n/a
4 TRCN0000038538 GCTACCAGTACCAAAGATAAA pLKO.1 1044 CDS 100% 13.200 9.240 N SLC16A10 n/a
5 TRCN0000271400 ATCCCGTGGATCCATAGTAAG pLKO_005 1686 CDS 100% 10.800 7.560 N SLC16A10 n/a
6 TRCN0000038536 CCTTTGCATACCAGCCTTCAT pLKO.1 823 5UTR 100% 4.950 3.465 N SLC16A10 n/a
7 TRCN0000038537 GCTCCCATAGCCTTTGAGTTA pLKO.1 1491 CDS 100% 4.950 3.465 N SLC16A10 n/a
8 TRCN0000271401 TACCTAAACCTCAAGTCTATG pLKO_005 2305 3UTR 100% 0.000 0.000 N SLC16A10 n/a
9 TRCN0000038535 CCTGGTGTGAAGAAGGTTTAT pLKO.1 1341 CDS 100% 13.200 7.920 N SLC16A10 n/a
10 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 3431 3UTR 100% 4.950 2.475 Y NPHS1 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 6463 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000127601 CGCTTGTAATCCCAGCACTTT pLKO.1 4886 3UTR 100% 4.950 2.475 Y CCDC30 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6464 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010237.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13065 pDONR223 100% 72.8% 72.3% None 1_222del;544T>C;802A>G n/a
2 ccsbBroad304_13065 pLX_304 0% 72.8% 72.3% V5 1_222del;544T>C;802A>G n/a
3 TRCN0000474056 CAGTCTAAAACTTGATTTTCAGAA pLX_317 49.6% 72.8% 72.3% V5 1_222del;544T>C;802A>G n/a
Download CSV