Transcript: Human XM_017010280.2

PREDICTED: Homo sapiens parkin coregulated (PACRG), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PACRG (135138)
Length:
1137
CDS:
263..1042

Additional Resources:

NCBI RefSeq record:
XM_017010280.2
NBCI Gene record:
PACRG (135138)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010280.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129776 CTTAAACAAATGCCCAGACAA pLKO.1 289 CDS 100% 4.950 6.930 N PACRG n/a
2 TRCN0000129893 GAAGCTGGATTACCATCATTA pLKO.1 565 CDS 100% 13.200 9.240 N PACRG n/a
3 TRCN0000129133 GAGAAGCTGGATTACCATCAT pLKO.1 563 CDS 100% 4.950 3.465 N PACRG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010280.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04899 pDONR223 100% 84.9% 75% None (many diffs) n/a
2 ccsbBroad304_04899 pLX_304 0% 84.9% 75% V5 (many diffs) n/a
3 TRCN0000469772 GCCCGCTGGTAGACAACCTGAAAC pLX_317 58.7% 84.9% 75% V5 (many diffs) n/a
4 ccsbBroadEn_04898 pDONR223 100% 84.9% 75% None (many diffs) n/a
5 ccsbBroad304_04898 pLX_304 0% 84.9% 75% V5 (many diffs) n/a
6 TRCN0000470221 AAGGAGTTCCTCTCAACATAGACA pLX_317 58% 84.9% 75% V5 (many diffs) n/a
Download CSV