Transcript: Human XM_017010366.2

PREDICTED: Homo sapiens EPH receptor A7 (EPHA7), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EPHA7 (2045)
Length:
1725
CDS:
244..1572

Additional Resources:

NCBI RefSeq record:
XM_017010366.2
NBCI Gene record:
EPHA7 (2045)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146678 CACCTGGTATGTTCGTATCG pXPR_003 GGG 202 15% 3 0.0351 EPHA7 EPHA7 77353
2 BRDN0001145766 CTGACTTAAGCCGATCCCAG pXPR_003 AGG 1281 96% 5 -0.0276 EPHA7 EPHA7 77352
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010366.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195051 CGATGTGACCTACAGAATATT pLKO.1 1326 CDS 100% 15.000 21.000 N EPHA7 n/a
2 TRCN0000318440 CGATGTGACCTACAGAATATT pLKO_005 1326 CDS 100% 15.000 21.000 N EPHA7 n/a
3 TRCN0000196517 GTACTACTGCTGGATTCTAAA pLKO.1 340 CDS 100% 13.200 10.560 N EPHA7 n/a
4 TRCN0000006421 TGGTCCATTATTGAGAACTTA pLKO.1 859 CDS 100% 5.625 3.938 N EPHA7 n/a
5 TRCN0000349550 TGGTCCATTATTGAGAACTTA pLKO_005 859 CDS 100% 5.625 3.938 N EPHA7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010366.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10803 pDONR223 100% 63% 62.6% None (many diffs) n/a
2 ccsbBroad304_10803 pLX_304 0% 63% 62.6% V5 (many diffs) n/a
3 TRCN0000468569 AAAGGCACATGGAGATCTATATTT pLX_317 51.8% 63% 62.6% V5 (many diffs) n/a
4 TRCN0000488943 CTGGTATCGTCGGTGTGCGGGGAA pLX_317 11.9% 44.4% 48.3% V5 (not translated due to prior stop codon) 981G>A;1324_1325insCTCCCTCGCAAGT;1326_1327ins1643 n/a
5 TRCN0000489864 TTAGACTCGCTATCAGCCAGGGCC pLX_317 13.7% 44.4% 48.3% V5 (not translated due to prior stop codon) 981G>A;1324_1325insCTCCCTCGCAAGT;1326_1327ins1644 n/a
6 ccsbBroadEn_06169 pDONR223 99.8% 44.2% 44.1% None 981G>A;1324_1325insCTCCCTCGCAAGT;1326_1327ins1655 n/a
7 ccsbBroad304_06169 pLX_304 0% 44.2% 44.1% V5 981G>A;1324_1325insCTCCCTCGCAAGT;1326_1327ins1655 n/a
Download CSV