Transcript: Human XM_017010370.2

PREDICTED: Homo sapiens EYA transcriptional coactivator and phosphatase 4 (EYA4), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EYA4 (2070)
Length:
8816
CDS:
163..2058

Additional Resources:

NCBI RefSeq record:
XM_017010370.2
NBCI Gene record:
EYA4 (2070)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010370.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244430 GTATAAGGACAGTCCTATTTA pLKO_005 5950 3UTR 100% 15.000 21.000 N EYA4 n/a
2 TRCN0000051093 CGGGTCTTATGCACAGAAGTA pLKO.1 1275 CDS 100% 4.950 6.930 N EYA4 n/a
3 TRCN0000051096 GCTTTGAACGAATAATGCAAA pLKO.1 1862 CDS 100% 4.950 6.930 N EYA4 n/a
4 TRCN0000218273 TTGCGAAGGTTCTACTCTATA pLKO_005 1778 CDS 100% 13.200 10.560 N EYA4 n/a
5 TRCN0000244429 TGCACCATCATCTACTATTTA pLKO_005 828 CDS 100% 15.000 10.500 N EYA4 n/a
6 TRCN0000218196 ACAGATTCCTGGCTAACAAAT pLKO_005 1675 CDS 100% 13.200 9.240 N EYA4 n/a
7 TRCN0000244428 TCAACGTATGGAGCGTATATG pLKO_005 955 CDS 100% 13.200 9.240 N EYA4 n/a
8 TRCN0000051097 GCGTGTGTTTGTCTGGGATTT pLKO.1 1218 CDS 100% 10.800 7.560 N EYA4 n/a
9 TRCN0000051095 CCTGGCTAACAAATGCACTTA pLKO.1 1682 CDS 100% 4.950 3.465 N EYA4 n/a
10 TRCN0000051094 GCAGCACATCAGTTACTACAA pLKO.1 338 CDS 100% 4.950 3.465 N EYA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010370.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06177 pDONR223 100% 95.6% 92.9% None (many diffs) n/a
2 ccsbBroad304_06177 pLX_304 0% 95.6% 92.9% V5 (many diffs) n/a
3 TRCN0000492103 TGTGGATTTAGGAAACATGCTTAT pLX_317 19.1% 95.6% 92.9% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000491821 GTCACTCCTGCCCGTATTAATGCA pLX_317 19.7% 95.6% 92.8% V5 (many diffs) n/a
Download CSV