Transcript: Human XM_017010383.1

PREDICTED: Homo sapiens estrogen receptor 1 (ESR1), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ESR1 (2099)
Length:
3313
CDS:
529..1527

Additional Resources:

NCBI RefSeq record:
XM_017010383.1
NBCI Gene record:
ESR1 (2099)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010383.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338158 GTGTGCCTCAAATCTATTATT pLKO_005 1075 CDS 100% 15.000 12.000 N ESR1 n/a
2 TRCN0000338159 CCCTCATCATGCACCACTTTA pLKO_005 1575 3UTR 100% 13.200 9.240 N ESR1 n/a
3 TRCN0000010774 GCAGGATTGTTGTGGCTACTA pLKO.1 2560 3UTR 100% 4.950 3.465 N ESR1 n/a
4 TRCN0000003301 CTCTACTTCATCGCATTCCTT pLKO.1 1455 CDS 100% 3.000 2.100 N ESR1 n/a
5 TRCN0000003299 AGCACCCTGAAGTCTCTGGAA pLKO.1 1129 CDS 100% 2.640 1.584 N ESR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010383.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00517 pDONR223 100% 55.7% 55.7% None 0_1ins789;186G>C n/a
2 ccsbBroad304_00517 pLX_304 26.5% 55.7% 55.7% V5 0_1ins789;186G>C n/a
3 TRCN0000481482 CTTTAGAGGTAACGCATGAACATC pLX_317 28.9% 55.7% 55.7% V5 0_1ins789;186G>C n/a
4 TRCN0000489098 TCCCTCCACCTGTGGTATTTTTAG pLX_317 18% 55.5% 55.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489532 TCGTCCCGATAGTGAGTTAACGCC pLX_317 15.2% 55.1% 55.2% V5 (many diffs) n/a
Download CSV