Transcript: Human XM_017010863.2

PREDICTED: Homo sapiens male germ cell associated kinase (MAK), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAK (4117)
Length:
3946
CDS:
271..2217

Additional Resources:

NCBI RefSeq record:
XM_017010863.2
NBCI Gene record:
MAK (4117)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010863.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001786 GATCCACTTAGCACCTCTCAA pLKO.1 2028 CDS 100% 4.950 6.930 N MAK n/a
2 TRCN0000001787 CTCTATATGTTAAGGCCACTT pLKO.1 847 CDS 100% 4.050 5.670 N MAK n/a
3 TRCN0000001788 CGTCAAATCATCTGGAATCAA pLKO.1 1148 CDS 100% 5.625 4.500 N MAK n/a
4 TRCN0000194697 CTTGATGACTTCAATAGTAAC pLKO.1 3249 3UTR 100% 10.800 7.560 N MAK n/a
5 TRCN0000001789 CAATGCCAGTAATGAAGCTAT pLKO.1 1023 CDS 100% 4.950 3.465 N MAK n/a
6 TRCN0000195056 CGATGGTAATTTCAATCTTGA pLKO.1 2773 3UTR 100% 4.950 3.465 N MAK n/a
7 TRCN0000001785 GCTGTGGTTCTTATTTGACTA pLKO.1 2678 3UTR 100% 4.950 3.465 N MAK n/a
8 TRCN0000194976 CCATCTTTAGTTGAGGTAGAG pLKO.1 1210 CDS 100% 4.050 2.835 N MAK n/a
9 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 2950 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
10 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 2985 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010863.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10956 pDONR223 100% 69.3% 68.3% None (many diffs) n/a
2 ccsbBroad304_10956 pLX_304 0% 69.3% 68.3% V5 (many diffs) n/a
3 TRCN0000469828 TCACTAAAAGCTTCGCAACATTTC pLX_317 30.1% 69.3% 68.3% V5 (many diffs) n/a
4 ccsbBroadEn_14692 pDONR223 0% 69.3% 68.3% None (many diffs) n/a
5 ccsbBroad304_14692 pLX_304 0% 69.3% 68.3% V5 (many diffs) n/a
6 TRCN0000479982 CGCACAATGCGTTGACGATATGGT pLX_317 29.7% 69.3% 68.3% V5 (many diffs) n/a
Download CSV