Transcript: Human XM_017010871.1

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase 5 (MAP3K5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP3K5 (4217)
Length:
5582
CDS:
358..4839

Additional Resources:

NCBI RefSeq record:
XM_017010871.1
NBCI Gene record:
MAP3K5 (4217)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010871.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431592 GCACTCCTTCATCGAGCTATT pLKO_005 4486 CDS 100% 10.800 15.120 N MAP3K5 n/a
2 TRCN0000416310 GCAAATACTGGAAGGATTAAA pLKO_005 3039 CDS 100% 15.000 10.500 N MAP3K5 n/a
3 TRCN0000219666 ATTCGGCAGCGAGTAGATAAT pLKO.1 1579 CDS 100% 13.200 9.240 N MAP3K5 n/a
4 TRCN0000219665 CAGTACTTCCGGGAATCTATA pLKO.1 1492 CDS 100% 13.200 9.240 N MAP3K5 n/a
5 TRCN0000419788 GCTCTTTCAGCTGGATCAAAT pLKO_005 3541 CDS 100% 13.200 9.240 N MAP3K5 n/a
6 TRCN0000427691 TAAAGTTCTTCGGAATCATAA pLKO_005 4101 CDS 100% 13.200 9.240 N MAP3K5 n/a
7 TRCN0000195438 CCTTGCATCTGAGAGTGATAC pLKO.1 4221 CDS 100% 10.800 7.560 N MAP3K5 n/a
8 TRCN0000195146 CCTTCTTATTTGTCTATCAAC pLKO.1 2398 CDS 100% 4.950 3.465 N MAP3K5 n/a
9 TRCN0000000992 CGGGACATAAAGGGTGACAAT pLKO.1 3088 CDS 100% 4.950 3.465 N MAP3K5 n/a
10 TRCN0000000995 CTGCGGAGAAAGAGATGTCAA pLKO.1 3696 CDS 100% 4.950 3.465 N MAP3K5 n/a
11 TRCN0000000994 GAAGACACTATAAGCCGGTTT pLKO.1 4654 CDS 100% 4.050 2.835 N MAP3K5 n/a
12 TRCN0000000993 GCTTACCTCTTGTGGATCGTT pLKO.1 1433 CDS 100% 3.000 2.100 N MAP3K5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010871.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488094 ACGAATCAGCTTAATCGTCTTCTC pLX_317 7.5% 91.2% 90.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488584 TTACTGGCCTAATCGATGTGTGTT pLX_317 7.8% 91.2% 90.6% V5 (many diffs) n/a
3 ccsbBroadEn_14695 pDONR223 10.9% 85.6% 2.7% None (many diffs) n/a
4 ccsbBroad304_14695 pLX_304 10.4% 85.6% 2.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000467146 TCTTGTTAAGTTATAACTTGTTTC pLX_317 8.2% 85.6% 2.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV