Transcript: Human XM_017010986.1

PREDICTED: Homo sapiens CDK5 regulatory subunit associated protein 1 like 1 (CDKAL1), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDKAL1 (54901)
Length:
1896
CDS:
168..1475

Additional Resources:

NCBI RefSeq record:
XM_017010986.1
NBCI Gene record:
CDKAL1 (54901)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010986.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364374 ATGACAAATCCGCCCTATATT pLKO_005 1041 CDS 100% 15.000 21.000 N CDKAL1 n/a
2 TRCN0000056646 CGAAGGTACGAAGGCGAAATA pLKO.1 274 CDS 100% 13.200 18.480 N CDKAL1 n/a
3 TRCN0000364306 CCGAAGGTACGAAGGCGAAAT pLKO_005 273 CDS 100% 10.800 15.120 N CDKAL1 n/a
4 TRCN0000056643 GCATGACAAATCCGCCCTATA pLKO.1 1039 CDS 100% 10.800 15.120 N CDKAL1 n/a
5 TRCN0000256110 CTAGCTGCTTATGGCTATAAA pLKO_005 426 CDS 100% 15.000 12.000 N CDKAL1 n/a
6 TRCN0000364304 GATTGGATTTGCCGAAGATTA pLKO_005 745 CDS 100% 13.200 10.560 N CDKAL1 n/a
7 TRCN0000364371 GGGCTTATGGCAGAGATATTG pLKO_005 949 CDS 100% 13.200 10.560 N CDKAL1 n/a
8 TRCN0000056645 CGATTGGATTTGCCGAAGATT pLKO.1 744 CDS 100% 5.625 4.500 N CDKAL1 n/a
9 TRCN0000256111 AGTTGTGGAGGAGACAATTAA pLKO_005 662 CDS 100% 15.000 10.500 N CDKAL1 n/a
10 TRCN0000256112 ATGCATCCGATGCAGATTTAT pLKO_005 457 CDS 100% 15.000 10.500 N CDKAL1 n/a
11 TRCN0000256113 ACTATTGCTACAGATATTATC pLKO_005 1236 CDS 100% 13.200 9.240 N CDKAL1 n/a
12 TRCN0000364305 AGCCTGTTTATTAACCAATTT pLKO_005 1329 CDS 100% 13.200 9.240 N CDKAL1 n/a
13 TRCN0000056644 CCTGAACAGTTGCACTGTAAA pLKO.1 482 CDS 100% 13.200 9.240 N CDKAL1 n/a
14 TRCN0000256114 GACCACTTTAGAAACTCAATT pLKO_005 516 CDS 100% 13.200 9.240 N CDKAL1 n/a
15 TRCN0000265738 ATTTGGCCAGTTATCCAATTG pLKO_005 853 CDS 100% 10.800 7.560 N CDKAL1 n/a
16 TRCN0000265766 TTAAGGGACTGAGTATCATTG pLKO_005 613 CDS 100% 10.800 7.560 N CDKAL1 n/a
17 TRCN0000364367 ACTTGTTGAAGAGTACAAATT pLKO_005 1304 CDS 100% 13.200 7.920 N CDKAL1 n/a
18 TRCN0000194337 CCACCAAGTGACAGCACTATT pLKO.1 327 CDS 100% 13.200 7.920 N Cdkal1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010986.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03477 pDONR223 100% 75% 74.9% None 1302_1303insGGTGAAAG;1305_1305delCins425 n/a
2 ccsbBroad304_03477 pLX_304 0% 75% 74.9% V5 1302_1303insGGTGAAAG;1305_1305delCins425 n/a
3 TRCN0000475115 ACTTGGTCCAGACCCATGATCACA pLX_317 30.9% 75% 74.9% V5 1302_1303insGGTGAAAG;1305_1305delCins425 n/a
4 ccsbBroadEn_14174 pDONR223 100% 21.7% 2% None 14_17delCCTG;285_286insGGT;289_1305del n/a
5 ccsbBroad304_14174 pLX_304 0% 21.7% 2% V5 (not translated due to prior stop codon) 14_17delCCTG;285_286insGGT;289_1305del n/a
6 TRCN0000468296 GAAAAGTAAGGACTTAGACTTGGT pLX_317 100% 21.7% 2% V5 (not translated due to prior stop codon) 14_17delCCTG;285_286insGGT;289_1305del n/a
Download CSV