Transcript: Human XM_017011005.2

PREDICTED: Homo sapiens DNA primase subunit 2 (PRIM2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRIM2 (5558)
Length:
2713
CDS:
86..1555

Additional Resources:

NCBI RefSeq record:
XM_017011005.2
NBCI Gene record:
PRIM2 (5558)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011005.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420795 ACGTACCACTTAAGGACATTG pLKO_005 708 CDS 100% 10.800 15.120 N PRIM2 n/a
2 TRCN0000000201 CACGAAGAAGAGATCATATTT pLKO.1 369 CDS 100% 15.000 10.500 N PRIM2 n/a
3 TRCN0000415435 GAAATGGATCTCCTTCGATTT pLKO_005 455 CDS 100% 10.800 7.560 N PRIM2 n/a
4 TRCN0000000200 CTACCCTCATTGCCTTCAGTT pLKO.1 148 CDS 100% 4.950 3.465 N PRIM2 n/a
5 TRCN0000431892 CCGAATGCAGTATGGCCTATT pLKO_005 1192 CDS 100% 10.800 6.480 N PRIM2 n/a
6 TRCN0000415928 AGTTCTGGAAGCAAGAATTTA pLKO_005 1251 CDS 100% 15.000 7.500 Y PRIM2 n/a
7 TRCN0000428211 TTGCATGCGTCAGTTACATAA pLKO_005 1135 CDS 100% 13.200 6.600 Y PRIM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011005.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06769 pDONR223 100% 72.8% 71.9% None (many diffs) n/a
2 ccsbBroad304_06769 pLX_304 0% 72.8% 71.9% V5 (many diffs) n/a
3 TRCN0000473120 TGATGACTGGCATGTACAAGCACC pLX_317 27.1% 72.8% 71.9% V5 (many diffs) n/a
4 ccsbBroadEn_15536 pDONR223 0% 32.1% 31.4% None (many diffs) n/a
5 ccsbBroad304_15536 pLX_304 0% 32.1% 31.4% V5 (many diffs) n/a
6 TRCN0000475396 GAGTCATTGGTGCACCTCATGTTC pLX_317 78.3% 32.1% 31.4% V5 (many diffs) n/a
Download CSV