Transcript: Human XM_017011085.1

PREDICTED: Homo sapiens adhesion G protein-coupled receptor G6 (ADGRG6), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADGRG6 (57211)
Length:
4813
CDS:
310..3660

Additional Resources:

NCBI RefSeq record:
XM_017011085.1
NBCI Gene record:
ADGRG6 (57211)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011085.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273861 ACACGGTTTATGTCGTTAATA pLKO_005 1649 CDS 100% 15.000 21.000 N ADGRG6 n/a
2 TRCN0000273811 ACTTAACCTCAGCCAATATTA pLKO_005 2111 CDS 100% 15.000 21.000 N ADGRG6 n/a
3 TRCN0000011560 CCAAGCAATAATGAATCGTAT pLKO.1 2413 CDS 100% 4.950 3.465 N ADGRG6 n/a
4 TRCN0000011561 CCCTTCTAGTTTACAATGCTA pLKO.1 1751 CDS 100% 3.000 2.100 N ADGRG6 n/a
5 TRCN0000011559 CCTCACTTTCATCAGCTATAT pLKO.1 2901 CDS 100% 13.200 7.920 N ADGRG6 n/a
6 TRCN0000273809 CCTCACTTTCATCAGCTATAT pLKO_005 2901 CDS 100% 13.200 7.920 N ADGRG6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011085.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488564 TCGAATCTTCTCCGCTGAAATTAC pLX_317 9.2% 86.7% 86.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488233 CTTTCCTGATTTACCATATGGCAG pLX_317 9.1% 86.6% 86.1% V5 (many diffs) n/a
3 ccsbBroadEn_14228 pDONR223 100% 86.6% 37.1% None (many diffs) n/a
4 ccsbBroad304_14228 pLX_304 0% 86.6% 37.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV