Transcript: Human XM_017012006.2

PREDICTED: Homo sapiens piccolo presynaptic cytomatrix protein (PCLO), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCLO (27445)
Length:
14642
CDS:
1565..10081

Additional Resources:

NCBI RefSeq record:
XM_017012006.2
NBCI Gene record:
PCLO (27445)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012006.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056484 CCACGAAATTATGTCCTAATT pLKO.1 6596 CDS 100% 1.320 1.848 N PCLO n/a
2 TRCN0000056486 CCCTTATGATAGCACCTGTTT pLKO.1 6423 CDS 100% 4.950 3.960 N PCLO n/a
3 TRCN0000056485 CCTCTGTCTATGGGCTTGATT pLKO.1 7356 CDS 100% 5.625 3.938 N PCLO n/a
4 TRCN0000056483 GCCCTATTAAAGGAGAGAGAA pLKO.1 5900 CDS 100% 4.950 3.465 N PCLO n/a
5 TRCN0000056487 CCCAGAATTCTGAAGAAGAAA pLKO.1 7533 CDS 100% 0.000 0.000 N PCLO n/a
6 TRCN0000200399 GTGGTTCAGAAGGAGCAAGAA pLKO.1 2147 CDS 100% 4.950 3.465 N Eif4h n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012006.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11867 pDONR223 100% 1.4% 1.1% None 1_6561del;6660_6667delTGTAAGAC;6693_8514del n/a
2 ccsbBroad304_11867 pLX_304 0% 1.4% 1.1% V5 1_6561del;6660_6667delTGTAAGAC;6693_8514del n/a
3 TRCN0000466005 CAACCGCAGTAGCTAGCACTAACG pLX_317 100% 1.4% 1.1% V5 1_6561del;6660_6667delTGTAAGAC;6693_8514del n/a
Download CSV