Transcript: Human XM_017012457.1

PREDICTED: Homo sapiens SMAD specific E3 ubiquitin protein ligase 1 (SMURF1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SMURF1 (57154)
Length:
5752
CDS:
339..2603

Additional Resources:

NCBI RefSeq record:
XM_017012457.1
NBCI Gene record:
SMURF1 (57154)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012457.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003474 CCGAAGGCTACGAACAAAGAA pLKO.1 1048 CDS 100% 5.625 7.875 N SMURF1 n/a
2 TRCN0000010791 CGATGGTTTGTTTGGTCCTTT pLKO.1 4912 3UTR 100% 4.950 6.930 N SMURF1 n/a
3 TRCN0000133939 CGTATGGTCCAAATTCAGATT pLKO.1 5298 3UTR 100% 4.950 6.930 N SMURF1 n/a
4 TRCN0000137075 CACTCACGTGTGATCTGTGTT pLKO.1 5014 3UTR 100% 4.950 3.960 N SMURF1 n/a
5 TRCN0000003473 CTGGAGGTTTATGAGAGGAAT pLKO.1 2117 CDS 100% 4.950 3.465 N SMURF1 n/a
6 TRCN0000003471 GCCCAGAGATACGAAAGAGAT pLKO.1 1449 CDS 100% 4.950 3.465 N SMURF1 n/a
7 TRCN0000134774 CAAAGAACTCAACATGGCAAA pLKO.1 4943 3UTR 100% 4.050 2.835 N SMURF1 n/a
8 TRCN0000003472 CCACTTGTCTTATTTCCACTT pLKO.1 1790 CDS 100% 4.050 2.835 N SMURF1 n/a
9 TRCN0000136284 GAACTCAACATGGCAAAGCAA pLKO.1 4947 3UTR 100% 3.000 2.100 N SMURF1 n/a
10 TRCN0000137047 CAGATTAAGGTGGTCACCCAA pLKO.1 5313 3UTR 100% 2.640 1.848 N SMURF1 n/a
11 TRCN0000135854 CCAAAGAACTCAACATGGCAA pLKO.1 4942 3UTR 100% 2.640 1.848 N SMURF1 n/a
12 TRCN0000134910 CCAAATTCAGATTAAGGTGGT pLKO.1 5306 3UTR 100% 2.160 1.512 N SMURF1 n/a
13 TRCN0000040574 GCCAAGAACCTTGCAAAGAAA pLKO.1 402 CDS 100% 5.625 3.375 N Smurf1 n/a
14 TRCN0000137504 GCTTTCAGTAGGAAGAGCTGA pLKO.1 5177 3UTR 100% 2.640 1.584 N SMURF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012457.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492102 CAGGTTCCCTGAGCTGCACGAGTC pLX_317 17.1% 96.1% 96.1% V5 (not translated due to prior stop codon) 805_882del;2087_2088insAGGTTCTAC n/a
2 TRCN0000489654 TTTCACGGAGCTGCGCAATGCGCC pLX_317 18% 96.1% 96% V5 805_882del;2087_2088insAGGTTCTAC;2262_2263insG n/a
Download CSV