Transcript: Human XM_017012549.1

PREDICTED: Homo sapiens actin related protein 3C (ACTR3C), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACTR3C (653857)
Length:
1413
CDS:
253..885

Additional Resources:

NCBI RefSeq record:
XM_017012549.1
NBCI Gene record:
ACTR3C (653857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012549.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108328 GCCATCGATAAACCTACATAT pLKO.1 1273 3UTR 100% 13.200 6.600 Y ACTR3B n/a
2 TRCN0000418383 CGATACGACATGGAATCATTG pLKO_005 1307 3UTR 100% 10.800 5.400 Y ACTR3B n/a
3 TRCN0000434511 TCATTGAAGACTGGGATCTTA pLKO_005 1322 3UTR 100% 5.625 2.813 Y ACTR3B n/a
4 TRCN0000423092 TAGGAGATGAAGCCATCGATA pLKO_005 1262 3UTR 100% 4.950 2.475 Y ACTR3B n/a
5 TRCN0000108327 CCAGGACTCTACATTGCAGTT pLKO.1 274 CDS 100% 4.050 2.025 Y ACTR3B n/a
6 TRCN0000414906 GAGTCAGCAAAGGTAGTTGAC pLKO_005 1192 3UTR 100% 4.050 2.025 Y ACTR3B n/a
7 TRCN0000090296 CCAGGACTCTACATTGCAGTA pLKO.1 274 CDS 100% 4.050 2.025 Y Actr3b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012549.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03802 pDONR223 100% 56% 54.5% None (many diffs) n/a
2 ccsbBroad304_03802 pLX_304 0% 56% 54.5% V5 (many diffs) n/a
3 TRCN0000491360 AAGTAAGAACTACCAGACTCACCT pLX_317 33.1% 56% 54.5% V5 (many diffs) n/a
4 ccsbBroadEn_03803 pDONR223 100% 46.5% 44.7% None (many diffs) n/a
5 ccsbBroad304_03803 pLX_304 0% 46.5% 44.7% V5 (many diffs) n/a
6 TRCN0000480353 AATTTTCGGGTCTCCGCCAGAGAG pLX_317 33.6% 46.5% 44.7% V5 (many diffs) n/a
Download CSV