Transcript: Human XM_017012561.2

PREDICTED: Homo sapiens SRSF protein kinase 2 (SRPK2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRPK2 (6733)
Length:
6484
CDS:
70..2247

Additional Resources:

NCBI RefSeq record:
XM_017012561.2
NBCI Gene record:
SRPK2 (6733)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145577 TCTTCACACAACGTACTGGG pXPR_003 AGG 668 31% 8 0.4655 SRPK2 SRPK2 75599
2 BRDN0001145583 TGACCCAAACAAAGACATGG pXPR_003 TGG 541 25% 7 0.4538 SRPK2 SRPK2 75600
3 BRDN0001146940 TTGGAGACCTCTTCAATGGC pXPR_003 CGG 345 16% 5 -0.0572 SRPK2 SRPK2 75601
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012561.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006277 CGTTGTGTGAAGAGTATCATT pLKO.1 742 CDS 100% 5.625 7.875 N SRPK2 n/a
2 TRCN0000277860 CGTTGTGTGAAGAGTATCATT pLKO_005 742 CDS 100% 5.625 7.875 N SRPK2 n/a
3 TRCN0000006275 GCCGGTATCATGTTATTAGAA pLKO.1 416 CDS 100% 5.625 4.500 N SRPK2 n/a
4 TRCN0000277858 GCCGGTATCATGTTATTAGAA pLKO_005 416 CDS 100% 5.625 4.500 N SRPK2 n/a
5 TRCN0000006276 CCTGAGGAATATAATCTTGAT pLKO.1 1411 CDS 100% 4.950 3.960 N SRPK2 n/a
6 TRCN0000277855 CCTGAGGAATATAATCTTGAT pLKO_005 1411 CDS 100% 4.950 3.960 N SRPK2 n/a
7 TRCN0000197040 GAGACAGCCTTGGATGAAATA pLKO.1 538 CDS 100% 13.200 9.240 N SRPK2 n/a
8 TRCN0000361544 TGTCTTCAGCTAAGTAGTTTA pLKO_005 2437 3UTR 100% 13.200 9.240 N Srpk2 n/a
9 TRCN0000006278 GCAACGGGAGATTATTTGTTT pLKO.1 1912 CDS 100% 5.625 3.938 N SRPK2 n/a
10 TRCN0000297051 GCAACGGGAGATTATTTGTTT pLKO_005 1912 CDS 100% 5.625 3.938 N SRPK2 n/a
11 TRCN0000006274 GCACCCTGTAAATGTTACTTT pLKO.1 2729 3UTR 100% 5.625 3.938 N SRPK2 n/a
12 TRCN0000277859 GCACCCTGTAAATGTTACTTT pLKO_005 2729 3UTR 100% 5.625 3.938 N SRPK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012561.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01594 pDONR223 100% 93% 93.5% None (many diffs) n/a
2 ccsbBroad304_01594 pLX_304 0% 93% 93.5% V5 (many diffs) n/a
3 ccsbBroadEn_14847 pDONR223 0% 93% 93.5% None (many diffs) n/a
4 ccsbBroad304_14847 pLX_304 0% 93% 93.5% V5 (many diffs) n/a
5 TRCN0000466082 GGAGGCGATTGTTTTCGAACATGA pLX_317 15.5% 92.9% 93.3% V5 (many diffs) n/a
6 TRCN0000489739 AGAACCGGCTTCTTCCAGTACGTG pLX_317 21.4% 92.9% 93.3% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000489410 TGGGACTGCATACCAAAGATACGG pLX_317 16.7% 92.9% 93.2% V5 (many diffs) n/a
8 ccsbBroadEn_06999 pDONR223 100% 92.8% 93.2% None (many diffs) n/a
9 ccsbBroad304_06999 pLX_304 0% 92.8% 93.2% V5 (many diffs) n/a
10 TRCN0000473240 CAAGGCTGTACCTCATATTCCTAA pLX_317 19% 92.8% 93.2% V5 (many diffs) n/a
Download CSV