Transcript: Human XM_017013251.1

PREDICTED: Homo sapiens Rho related BTB domain containing 2 (RHOBTB2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RHOBTB2 (23221)
Length:
9775
CDS:
4799..7048

Additional Resources:

NCBI RefSeq record:
XM_017013251.1
NBCI Gene record:
RHOBTB2 (23221)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013251.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000441367 AGAGGGTGGAGCTCTTCTTAC pLKO_005 7167 3UTR 100% 10.800 15.120 N RHOBTB2 n/a
2 TRCN0000047966 CCATGTCAAGACCATGTGGTA pLKO.1 5212 CDS 100% 2.640 3.696 N RHOBTB2 n/a
3 TRCN0000429168 GTCGCTTTGCTTATGGGAGAT pLKO_005 5142 CDS 100% 4.050 3.240 N RHOBTB2 n/a
4 TRCN0000047963 GCCCATCAAACCTAATGAAAT pLKO.1 5347 CDS 100% 13.200 9.240 N RHOBTB2 n/a
5 TRCN0000420663 ACGGACTTGAGTGTTGCATTT pLKO_005 7479 3UTR 100% 10.800 7.560 N RHOBTB2 n/a
6 TRCN0000412390 ATGACATGAAGCTCATCATTC pLKO_005 6573 CDS 100% 10.800 7.560 N RHOBTB2 n/a
7 TRCN0000047964 GCCAAACGTAGAGACCATCAA pLKO.1 4891 CDS 100% 4.950 3.465 N RHOBTB2 n/a
8 TRCN0000424971 GGTCTTTGATCTGCGCATGAT pLKO_005 6232 CDS 100% 4.950 3.465 N RHOBTB2 n/a
9 TRCN0000437339 GGTGGTGTTTCCCTACACAAG pLKO_005 6484 CDS 100% 4.050 2.835 N RHOBTB2 n/a
10 TRCN0000437379 GTAAGACCAGGCTCATCTGTG pLKO_005 4941 CDS 100% 4.050 2.835 N RHOBTB2 n/a
11 TRCN0000430574 TAGATGATGTCAGCGTCTCTC pLKO_005 5082 CDS 100% 4.050 2.835 N RHOBTB2 n/a
12 TRCN0000047967 GCACCAACTACAACAACGTGT pLKO.1 6771 CDS 100% 2.640 1.848 N RHOBTB2 n/a
13 TRCN0000047965 CCTTCTCAGATGTGACCTTCA pLKO.1 6357 CDS 100% 4.050 2.430 N RHOBTB2 n/a
14 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 904 5UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
15 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 1011 5UTR 100% 1.080 0.540 Y GPR83 n/a
16 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 1011 5UTR 100% 1.080 0.540 Y MYORG n/a
17 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 1834 5UTR 100% 4.950 2.475 Y C16orf89 n/a
18 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 977 5UTR 100% 4.950 2.475 Y LOC387873 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013251.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07857 pDONR223 100% 97% 97% None 1_66del;930T>C n/a
2 ccsbBroad304_07857 pLX_304 0% 97% 97% V5 1_66del;930T>C n/a
3 TRCN0000477987 ACGAAAGATTAGGCACAAGGACTT pLX_317 6.9% 97% 97% V5 1_66del;930T>C n/a
Download CSV