Transcript: Human XM_017013426.1

PREDICTED: Homo sapiens aspartate beta-hydroxylase (ASPH), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ASPH (444)
Length:
5222
CDS:
104..2419

Additional Resources:

NCBI RefSeq record:
XM_017013426.1
NBCI Gene record:
ASPH (444)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013426.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053359 CGCTCACTCTACAATGTGAAT pLKO.1 1745 CDS 100% 4.950 6.930 N ASPH n/a
2 TRCN0000053362 CGTGGTTTATGGTGATTGCAT pLKO.1 183 CDS 100% 3.000 4.200 N ASPH n/a
3 TRCN0000310510 CGTGGTTTATGGTGATTGCAT pLKO_005 183 CDS 100% 3.000 4.200 N ASPH n/a
4 TRCN0000053358 CGGCTGATATTCATCGTGGAT pLKO.1 2345 CDS 100% 2.640 3.696 N ASPH n/a
5 TRCN0000303762 ACGCAGCCTTCCAGCAATTTA pLKO_005 2398 CDS 100% 15.000 10.500 N ASPH n/a
6 TRCN0000303761 TGGGAACAAAGAGGCATATAA pLKO_005 1675 CDS 100% 15.000 10.500 N ASPH n/a
7 TRCN0000303760 GGGCTACACAGAGTTAGTAAA pLKO_005 1804 CDS 100% 13.200 9.240 N ASPH n/a
8 TRCN0000331331 TGACTTGCAGCCCGAGTAATT pLKO_005 2524 3UTR 100% 13.200 9.240 N ASPH n/a
9 TRCN0000053361 CCCATATTTAAAGGAAGGAAT pLKO.1 1585 CDS 100% 4.950 3.465 N ASPH n/a
10 TRCN0000053360 CCTGAGGATAATCCTGTAGAA pLKO.1 908 CDS 100% 4.950 3.465 N ASPH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013426.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00115 pDONR223 100% 29.6% 29.3% None (many diffs) n/a
2 ccsbBroad304_00115 pLX_304 0% 29.6% 29.3% V5 (many diffs) n/a
3 TRCN0000468251 ACTATCGGAACGAACTTGACCCCG pLX_317 44.4% 29.6% 29.3% V5 (many diffs) n/a
4 ccsbBroadEn_15361 pDONR223 0% 17.8% 14.3% None (many diffs) n/a
5 ccsbBroad304_15361 pLX_304 0% 17.8% 14.3% V5 (many diffs) n/a
6 TRCN0000480274 ATCGAGGCCAAGAGTAGCCAAATT pLX_317 63.5% 17.8% 14.3% V5 (many diffs) n/a
Download CSV