Transcript: Human XM_017015166.2

PREDICTED: Homo sapiens bromodomain containing 3 (BRD3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BRD3 (8019)
Length:
2427
CDS:
469..1686

Additional Resources:

NCBI RefSeq record:
XM_017015166.2
NBCI Gene record:
BRD3 (8019)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021378 GAGATATGTCAAGTCTTGTTT pLKO.1 1395 CDS 100% 5.625 7.875 N BRD3 n/a
2 TRCN0000199455 GTGAGATTCGTACCGAAGAAC pLKO.1 1976 3UTR 100% 4.950 6.930 N BRD3 n/a
3 TRCN0000196574 GTGGTTCATATTACTACTTCT pLKO.1 1751 3UTR 100% 4.950 6.930 N BRD3 n/a
4 TRCN0000199822 GCGTTAGACTTGATGAGAAGG pLKO.1 1861 3UTR 100% 4.050 5.670 N BRD3 n/a
5 TRCN0000021376 GCTGATGTTCTCGAATTGCTA pLKO.1 648 CDS 100% 3.000 2.400 N BRD3 n/a
6 TRCN0000021374 CCAAGGAAATGTCTCGGATAT pLKO.1 2055 3UTR 100% 10.800 7.560 N BRD3 n/a
7 TRCN0000199036 CCCACCACTTTGCGGGAACTG pLKO.1 1372 CDS 100% 0.000 0.000 N BRD3 n/a
8 TRCN0000140823 GAAGGAGAAGAAGGAGAAGGT pLKO.1 978 CDS 100% 2.640 1.320 Y PTMS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11251 pDONR223 100% 31.3% 31.4% None (many diffs) n/a
2 ccsbBroad304_11251 pLX_304 0% 31.3% 31.4% V5 (many diffs) n/a
3 TRCN0000478055 CGGTGGTTACGTATCGCTACCCCC pLX_317 19.6% 31.3% 31.4% V5 (many diffs) n/a
4 ccsbBroadEn_14888 pDONR223 93.2% 31.1% 13.8% None (many diffs) n/a
5 ccsbBroad304_14888 pLX_304 0% 31.1% 13.8% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000473067 TGACGGGCAGCCGACGCTAGCAGT pLX_317 19.6% 31.1% 13.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV