Transcript: Human XM_017015619.1

PREDICTED: Homo sapiens chromosome 10 open reading frame 71 (C10orf71), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C10orf71 (118461)
Length:
7714
CDS:
553..4422

Additional Resources:

NCBI RefSeq record:
XM_017015619.1
NBCI Gene record:
C10orf71 (118461)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015619.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146858 CATCAACACATACTTAGCCTT pLKO.1 4535 3UTR 100% 2.640 3.696 N C10orf71 n/a
2 TRCN0000146429 CTCACTTGTAAGCTCCTTGAT pLKO.1 4824 3UTR 100% 4.950 3.960 N C10orf71 n/a
3 TRCN0000146510 CTAGAGGTAAGGTTGATGGAA pLKO.1 1694 CDS 100% 3.000 2.400 N C10orf71 n/a
4 TRCN0000127607 CCAGGTTTCAAGAGTCACTTT pLKO.1 3199 CDS 100% 4.950 3.465 N C10orf71 n/a
5 TRCN0000129559 CGAGACAGCTACAAGTCCAAA pLKO.1 1579 CDS 100% 4.950 3.465 N C10orf71 n/a
6 TRCN0000146777 CAGACAGCTATCTAACTCTTA pLKO.1 1868 CDS 100% 4.950 2.970 N C10orf71 n/a
7 TRCN0000148519 CATAAAGTCCAGAAGGCAGTA pLKO.1 4564 3UTR 100% 4.050 2.430 N C10orf71 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4495 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015619.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13068 pDONR223 100% 38.8% 37.5% None (many diffs) n/a
2 ccsbBroad304_13068 pLX_304 0% 38.8% 37.5% V5 (many diffs) n/a
3 TRCN0000471401 CTCGCCAAACAATTCTACCCGCGG pLX_317 12.8% 38.8% 37.5% V5 (many diffs) n/a
Download CSV