Transcript: Human XM_017016657.1

PREDICTED: Homo sapiens major facilitator superfamily domain containing 13A (MFSD13A), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MFSD13A (79847)
Length:
2224
CDS:
843..2189

Additional Resources:

NCBI RefSeq record:
XM_017016657.1
NBCI Gene record:
MFSD13A (79847)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016657.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243140 CATCTGTTGTCCGACCATATC pLKO_005 1719 CDS 100% 10.800 15.120 N MFSD13A n/a
2 TRCN0000243138 ATGTCTTCCTGCTCTACTATG pLKO_005 934 CDS 100% 10.800 7.560 N MFSD13A n/a
3 TRCN0000180822 GCATCTGTTGTCCGACCATAT pLKO.1 1718 CDS 100% 10.800 7.560 N MFSD13A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016657.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08968 pDONR223 100% 85.7% 82.5% None (many diffs) n/a
2 ccsbBroad304_08968 pLX_304 0% 85.7% 82.5% V5 (many diffs) n/a
3 TRCN0000475486 ACCACTAATACATCGGAACCCTTT pLX_317 19.1% 85.7% 82.5% V5 (many diffs) n/a
4 ccsbBroadEn_12632 pDONR223 100% 33.5% 30.9% None (many diffs) n/a
5 ccsbBroad304_12632 pLX_304 0% 33.5% 30.9% V5 (many diffs) n/a
6 TRCN0000478750 AGGCGAGTGGAGCTCAATCTTCAT pLX_317 60% 33.5% 30.9% V5 (many diffs) n/a
Download CSV