Transcript: Human XM_017017739.2

PREDICTED: Homo sapiens aryl hydrocarbon receptor nuclear translocator like (ARNTL), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARNTL (406)
Length:
2995
CDS:
474..2483

Additional Resources:

NCBI RefSeq record:
XM_017017739.2
NBCI Gene record:
ARNTL (406)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000331079 AGAACCCAGGTTATCCATATT pLKO_005 2281 CDS 100% 13.200 18.480 N ARNTL n/a
2 TRCN0000331078 GCAACAGCTATAGTATCAAAG pLKO_005 2502 3UTR 100% 10.800 15.120 N ARNTL n/a
3 TRCN0000019095 GCACGCGATAGATGGAAAGTT pLKO.1 1631 CDS 100% 5.625 7.875 N ARNTL n/a
4 TRCN0000331011 GCACGCGATAGATGGAAAGTT pLKO_005 1631 CDS 100% 5.625 7.875 N ARNTL n/a
5 TRCN0000019098 GCTCCACTGACTACCAAGAAA pLKO.1 727 CDS 100% 5.625 7.875 N ARNTL n/a
6 TRCN0000019097 GCAGAATGTCATAGGCAAGTT pLKO.1 1758 CDS 100% 4.950 6.930 N ARNTL n/a
7 TRCN0000331012 GCAGAATGTCATAGGCAAGTT pLKO_005 1758 CDS 100% 4.950 6.930 N ARNTL n/a
8 TRCN0000095058 CCCTCATGGAAGGTTAGAATA pLKO.1 770 CDS 100% 13.200 10.560 N Arntl n/a
9 TRCN0000331014 CTTCTAGGCACATCGTGTTAT pLKO_005 1704 CDS 100% 13.200 10.560 N ARNTL n/a
10 TRCN0000019096 CAACGCAATGTCCAGGAAATT pLKO.1 908 CDS 100% 13.200 9.240 N ARNTL n/a
11 TRCN0000019094 GCCGAATGATTGCTGAGGAAA pLKO.1 2089 CDS 100% 4.950 3.465 N ARNTL n/a
12 TRCN0000095054 CCATTGATACAAGTCAATCTA pLKO.1 2615 3UTR 100% 0.563 0.788 N Arntl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00105 pDONR223 100% 93.4% 93.4% None 1_129del;948_950delAGC n/a
2 ccsbBroad304_00105 pLX_304 35.1% 93.4% 93.4% V5 1_129del;948_950delAGC n/a
3 TRCN0000481576 CTCTCTCTTCCCAACTTCCTAGGC pLX_317 23.2% 93.4% 93.4% V5 1_129del;948_950delAGC n/a
4 ccsbBroadEn_15360 pDONR223 0% 86.8% 86.5% None (many diffs) n/a
5 ccsbBroad304_15360 pLX_304 0% 86.8% 86.5% V5 (many diffs) n/a
Download CSV