Transcript: Human XM_017017792.2

PREDICTED: Homo sapiens ATM serine/threonine kinase (ATM), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATM (472)
Length:
6140
CDS:
734..6061

Additional Resources:

NCBI RefSeq record:
XM_017017792.2
NBCI Gene record:
ATM (472)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017792.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039952 GCTAGAATAATTCATGCTGTT pLKO.1 1295 CDS 100% 4.050 5.670 N ATM n/a
2 TRCN0000039949 GCACGCTAGAACCTACCAAAT pLKO.1 3534 CDS 100% 10.800 8.640 N ATM n/a
3 TRCN0000038655 GCCGTCAACTAGAACATGATA pLKO.1 768 CDS 100% 5.625 4.500 N ATM n/a
4 TRCN0000245106 GCCGTCAACTAGAACATGATA pLKO_005 768 CDS 100% 5.625 4.500 N ATM n/a
5 TRCN0000245107 CGAGATCCTGAAACAATTAAA pLKO_005 836 CDS 100% 15.000 10.500 N ATM n/a
6 TRCN0000039950 CCTGAAACTTTGGATGAAATT pLKO.1 4154 CDS 100% 13.200 9.240 N ATM n/a
7 TRCN0000038656 GCCATAATTCAGGGTAGTTTA pLKO.1 2261 CDS 100% 13.200 9.240 N ATM n/a
8 TRCN0000245108 TGGTCAAATACTTCATCAAAT pLKO_005 1032 CDS 100% 13.200 9.240 N ATM n/a
9 TRCN0000194686 CCTGCGATTGTTAACATCAAA pLKO.1 3142 CDS 100% 5.625 3.938 N ATM n/a
10 TRCN0000194861 CCAAGGTCTATGATATGCTTA pLKO.1 4680 CDS 100% 4.950 3.465 N ATM n/a
11 TRCN0000039951 GCCTCCAATTCTTCACAGTAA pLKO.1 2518 CDS 100% 4.950 3.465 N ATM n/a
12 TRCN0000196335 GTATTACCTTTCGTGGTATAA pLKO.1 2199 CDS 100% 13.200 7.920 N ATM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017792.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10689 pDONR223 100% 7.3% 7.3% None 1_4044del;4438_5325del n/a
2 ccsbBroad304_10689 pLX_304 97.8% 7.3% 7.3% V5 1_4044del;4438_5325del n/a
3 TRCN0000471841 AACTATAAGACCCGGATATGCACT pLX_317 100% 7.3% 7.3% V5 1_4044del;4438_5325del n/a
4 ccsbBroadEn_10688 pDONR223 100% 6.2% 6.1% None 332_333insTA;335_5325del n/a
5 ccsbBroad304_10688 pLX_304 97.4% 6.2% 6.1% V5 332_333insTA;335_5325del n/a
6 TRCN0000491887 TGGTATTGATTCTCGAAGGTGCCG pLX_317 91.8% 6.2% 6.1% V5 332_333insTA;335_5325del n/a
Download CSV