Transcript: Human XM_017018331.2

PREDICTED: Homo sapiens ATP/GTP binding protein like 2 (AGBL2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AGBL2 (79841)
Length:
3018
CDS:
238..2718

Additional Resources:

NCBI RefSeq record:
XM_017018331.2
NBCI Gene record:
AGBL2 (79841)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018331.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073912 GCCTAGCAGGAAATACCGTTT pLKO.1 1406 CDS 100% 4.050 3.240 N AGBL2 n/a
2 TRCN0000073909 CCCATATACATACACTGATTT pLKO.1 1311 CDS 100% 13.200 9.240 N AGBL2 n/a
3 TRCN0000425030 CTTCTATGGCCTATCAGTTTA pLKO_005 463 CDS 100% 13.200 9.240 N AGBL2 n/a
4 TRCN0000427236 AGACTAGGAAACAGCGAAATG pLKO_005 2387 CDS 100% 10.800 7.560 N AGBL2 n/a
5 TRCN0000416771 GTGGCGGATGGGAATCCTAAA pLKO_005 1977 CDS 100% 10.800 7.560 N AGBL2 n/a
6 TRCN0000073910 CCCAAGGTTAAATGAGACAAA pLKO.1 2556 CDS 100% 4.950 3.465 N AGBL2 n/a
7 TRCN0000073911 CCTGATCCTTATGAAGACTTT pLKO.1 277 CDS 100% 4.950 3.465 N AGBL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018331.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12631 pDONR223 100% 27.5% 26.6% None (many diffs) n/a
2 ccsbBroad304_12631 pLX_304 0% 27.5% 26.6% V5 (many diffs) n/a
3 TRCN0000476430 ACACAAACTGAACTCCCTACATGC pLX_317 43.4% 27.5% 26.6% V5 (many diffs) n/a
Download CSV